Incidental Mutation 'R8988:Psg21'
ID 684216
Institutional Source Beutler Lab
Gene Symbol Psg21
Ensembl Gene ENSMUSG00000070796
Gene Name pregnancy-specific glycoprotein 21
Synonyms 1600026N13Rik, 1600019C01Rik, 1600025N01Rik, cea8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock # R8988 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 18646736-18656725 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18652464 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 199 (V199A)
Ref Sequence ENSEMBL: ENSMUSP00000092387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094793] [ENSMUST00000182128]
AlphaFold Q9DAV5
Predicted Effect probably benign
Transcript: ENSMUST00000094793
AA Change: V199A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000092387
Gene: ENSMUSG00000070796
AA Change: V199A

DomainStartEndE-ValueType
IG 39 138 3.04e-3 SMART
IG 159 260 7.25e-1 SMART
IG 276 375 1.25e-4 SMART
IGc2 393 457 1.47e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182128
AA Change: V199A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000138173
Gene: ENSMUSG00000070796
AA Change: V199A

DomainStartEndE-ValueType
IG 39 138 3.04e-3 SMART
IG 159 260 7.25e-1 SMART
IG 276 375 1.25e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 96% (81/84)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A G 3: 88,699,979 N330S probably benign Het
Abi2 C T 1: 60,450,092 T291I probably benign Het
Aox1 A C 1: 58,049,466 D137A possibly damaging Het
Apbb2 T C 5: 66,452,101 K68E probably damaging Het
Arf3 A T 15: 98,741,052 M108K probably benign Het
Atg2b T A 12: 105,617,129 I2058F probably damaging Het
Bhlhe40 C T 6: 108,662,557 L99F probably damaging Het
Cyp2b10 G A 7: 25,926,245 R500H probably damaging Het
Dlc1 C T 8: 36,572,843 E937K probably damaging Het
Dll3 A T 7: 28,296,368 V336D possibly damaging Het
Dync2h1 A G 9: 7,037,727 F3377L probably benign Het
Eef1d A G 15: 75,896,311 Y561H probably damaging Het
Epb41l1 C A 2: 156,521,671 T700K probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Ephb2 C A 4: 136,675,458 G501C probably benign Het
Erbb3 T C 10: 128,570,161 Y1129C probably damaging Het
Fbn1 C T 2: 125,370,806 V799M possibly damaging Het
Fbxo9 G A 9: 78,084,651 P353S probably benign Het
Ggt1 T G 10: 75,576,222 V100G probably benign Het
Gm11639 T G 11: 105,020,526 V4544G probably benign Het
Gm45861 T C 8: 27,542,503 M885T unknown Het
Gm609 T C 16: 45,417,908 H294R probably benign Het
Grin2d A T 7: 45,834,001 Y917* probably null Het
Hectd4 T A 5: 121,277,756 V540D possibly damaging Het
Helz T A 11: 107,604,253 I351K probably damaging Het
Ighv2-6-8 A G 12: 113,796,360 V43A probably damaging Het
Igkv9-129 T A 6: 67,840,122 I70N probably damaging Het
Il18 A T 9: 50,577,878 D69V probably damaging Het
Kcnh7 T A 2: 62,721,865 E927D Het
Kcnt2 T A 1: 140,428,849 V342E probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Krt18 C G 15: 102,029,527 A153G probably damaging Het
Lmntd2 A T 7: 141,212,064 probably benign Het
Lrrc26 G T 2: 25,290,274 A96S probably benign Het
Map3k11 A T 19: 5,702,138 S783C probably damaging Het
Mib2 G A 4: 155,656,272 L632F possibly damaging Het
Mical2 A C 7: 112,311,454 D277A possibly damaging Het
Mtr A T 13: 12,235,479 F339L probably benign Het
Musk T C 4: 58,354,032 F362L probably benign Het
Ncor1 G A 11: 62,343,045 Q444* probably null Het
Nek4 T C 14: 30,963,967 S279P Het
Nell1 C T 7: 50,560,795 T348I unknown Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nrip1 T C 16: 76,292,014 H885R probably damaging Het
Olfr1382 C A 11: 49,535,201 N5K probably damaging Het
Olfr214 A G 6: 116,557,294 T290A possibly damaging Het
Olfr448 T A 6: 42,897,267 V272D Het
Olfr525 G A 7: 140,323,025 G109R possibly damaging Het
Olfr784 T C 10: 129,388,371 V246A probably damaging Het
Olfr822 T A 10: 130,074,653 V81D possibly damaging Het
Otog A G 7: 46,310,147 D720G probably damaging Het
P3h3 C A 6: 124,857,601 Q29H possibly damaging Het
Parn A G 16: 13,648,417 probably null Het
Pcnt C A 10: 76,409,573 E1077* probably null Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pigb A G 9: 73,022,294 W336R probably damaging Het
Pkdrej A T 15: 85,816,337 S1799R probably damaging Het
Pnpla6 G T 8: 3,517,401 M86I possibly damaging Het
Prickle2 T C 6: 92,458,639 K50E possibly damaging Het
Reep3 T C 10: 67,036,007 probably null Het
Reln T C 5: 21,899,157 D3272G probably damaging Het
Rps6ka4 A G 19: 6,831,299 V526A possibly damaging Het
Sel1l3 T C 5: 53,123,429 E911G probably damaging Het
Serpinb6b C A 13: 32,978,142 A308E probably benign Het
Slc26a4 A G 12: 31,522,524 V746A probably benign Het
Slc4a3 T G 1: 75,551,313 M402R probably damaging Het
Slc9b1 A T 3: 135,373,139 T186S possibly damaging Het
Slk A G 19: 47,620,273 Q555R probably benign Het
Smc2 T A 4: 52,475,100 D925E probably benign Het
Stat5a A T 11: 100,883,938 T758S unknown Het
Sulf1 A G 1: 12,836,275 S514G probably benign Het
Tcp11l1 T A 2: 104,706,508 N4I probably damaging Het
Tex2 A T 11: 106,511,905 I1047K unknown Het
Tmem184b A G 15: 79,377,064 V114A possibly damaging Het
Trmt11 A G 10: 30,591,031 V95A probably benign Het
Trp53bp2 A G 1: 182,440,868 D169G possibly damaging Het
Ttc41 T A 10: 86,713,735 N264K possibly damaging Het
Uba2 A C 7: 34,154,562 S318R probably benign Het
Wapl T A 14: 34,729,182 N724K probably damaging Het
Wfdc9 T A 2: 164,651,751 I5F probably damaging Het
Zan C T 5: 137,408,301 D3686N unknown Het
Zfp618 A T 4: 63,094,471 Y140F probably benign Het
Zfp790 A G 7: 29,828,168 T93A probably benign Het
Zfp979 A C 4: 147,613,527 F242V probably benign Het
Other mutations in Psg21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:Psg21 APN 7 18654825 missense probably damaging 1.00
IGL02390:Psg21 APN 7 18652631 missense probably benign 0.11
IGL02548:Psg21 APN 7 18655036 missense possibly damaging 0.89
IGL03001:Psg21 APN 7 18652485 missense probably benign 0.03
IGL03135:Psg21 APN 7 18654918 missense probably benign 0.00
R0131:Psg21 UTSW 7 18654868 missense probably benign 0.39
R0551:Psg21 UTSW 7 18652640 critical splice acceptor site probably null
R1512:Psg21 UTSW 7 18656500 missense probably benign 0.00
R1874:Psg21 UTSW 7 18650816 missense probably benign 0.15
R1993:Psg21 UTSW 7 18654770 missense probably benign 0.04
R2327:Psg21 UTSW 7 18652453 missense possibly damaging 0.61
R3414:Psg21 UTSW 7 18652380 missense probably damaging 1.00
R4422:Psg21 UTSW 7 18647332 missense probably damaging 1.00
R5138:Psg21 UTSW 7 18656528 start codon destroyed probably null 0.94
R5623:Psg21 UTSW 7 18655014 missense probably damaging 1.00
R5686:Psg21 UTSW 7 18652258 intron probably benign
R6166:Psg21 UTSW 7 18656739 unclassified probably benign
R6177:Psg21 UTSW 7 18652354 missense possibly damaging 0.64
R6190:Psg21 UTSW 7 18655001 missense possibly damaging 0.61
R6210:Psg21 UTSW 7 18652345 missense probably damaging 1.00
R6482:Psg21 UTSW 7 18654739 splice site probably null
R6729:Psg21 UTSW 7 18652591 missense probably damaging 1.00
R6866:Psg21 UTSW 7 18652284 missense probably damaging 1.00
R6992:Psg21 UTSW 7 18654743 critical splice donor site probably null
R7075:Psg21 UTSW 7 18654861 missense probably damaging 1.00
R7081:Psg21 UTSW 7 18654849 nonsense probably null
R7098:Psg21 UTSW 7 18652545 missense probably damaging 1.00
R7582:Psg21 UTSW 7 18647203 makesense probably null
R7588:Psg21 UTSW 7 18647209 missense probably benign 0.00
R7607:Psg21 UTSW 7 18654783 missense probably benign 0.02
R7830:Psg21 UTSW 7 18647298 missense probably damaging 1.00
R7964:Psg21 UTSW 7 18647211 missense probably benign 0.01
R8758:Psg21 UTSW 7 18650753 missense probably damaging 1.00
R8972:Psg21 UTSW 7 18647368 missense probably benign 0.03
R9119:Psg21 UTSW 7 18647484 missense probably benign 0.14
R9446:Psg21 UTSW 7 18654940 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGTGCTCCTGGTAGAAGC -3'
(R):5'- TCATTTCACCTGTGGGCGTC -3'

Sequencing Primer
(F):5'- GAATCACTTACTCTCCACCTGAAGG -3'
(R):5'- ACCTGTGGGCGTCCTTCC -3'
Posted On 2021-10-11