Incidental Mutation 'R8988:Mical2'
ID 684224
Institutional Source Beutler Lab
Gene Symbol Mical2
Ensembl Gene ENSMUSG00000038244
Gene Name microtubule associated monooxygenase, calponin and LIM domain containing 2
Synonyms 4921517J23Rik, Ebitein1, 5330438E18Rik, Micalcl
MMRRC Submission 068820-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.298) question?
Stock # R8988 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 111825063-112012313 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 111910661 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 277 (D277A)
Ref Sequence ENSEMBL: ENSMUSP00000047639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037991] [ENSMUST00000050149]
AlphaFold Q8BML1
Q9D5U9
Predicted Effect possibly damaging
Transcript: ENSMUST00000037991
AA Change: D277A

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000047639
Gene: ENSMUSG00000038244
AA Change: D277A

DomainStartEndE-ValueType
Pfam:FAD_binding_3 86 143 1e-8 PFAM
Pfam:FAD_binding_2 88 127 3.2e-6 PFAM
low complexity region 175 188 N/A INTRINSIC
low complexity region 500 515 N/A INTRINSIC
CH 518 617 4.14e-17 SMART
low complexity region 691 700 N/A INTRINSIC
low complexity region 894 925 N/A INTRINSIC
LIM 979 1033 9.91e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000050149
AA Change: D277A

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000051163
Gene: ENSMUSG00000038244
AA Change: D277A

DomainStartEndE-ValueType
Pfam:FAD_binding_3 86 143 1.1e-8 PFAM
Pfam:FAD_binding_2 88 127 1.5e-6 PFAM
Pfam:Pyr_redox_2 88 259 1.3e-6 PFAM
low complexity region 500 515 N/A INTRINSIC
CH 518 617 4.14e-17 SMART
low complexity region 691 700 N/A INTRINSIC
LIM 752 806 9.91e-10 SMART
low complexity region 918 926 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a monooxygenase that enhances depolymerization of F-actin and is therefore involved in cytoskeletal dynamics. The encoded protein is a regulator of the SRF signaling pathway. Increased expression of this gene has been associated with cancer progression and metastasis. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi2 C T 1: 60,489,251 (GRCm39) T291I probably benign Het
Aox1 A C 1: 58,088,625 (GRCm39) D137A possibly damaging Het
Apbb2 T C 5: 66,609,444 (GRCm39) K68E probably damaging Het
Arf3 A T 15: 98,638,933 (GRCm39) M108K probably benign Het
Atg2b T A 12: 105,583,388 (GRCm39) I2058F probably damaging Het
Bhlhe40 C T 6: 108,639,518 (GRCm39) L99F probably damaging Het
Cd200l1 T C 16: 45,238,271 (GRCm39) H294R probably benign Het
Cyp2b10 G A 7: 25,625,670 (GRCm39) R500H probably damaging Het
Dlc1 C T 8: 37,039,997 (GRCm39) E937K probably damaging Het
Dll3 A T 7: 27,995,793 (GRCm39) V336D possibly damaging Het
Dync2h1 A G 9: 7,037,727 (GRCm39) F3377L probably benign Het
Eef1d A G 15: 75,768,160 (GRCm39) Y561H probably damaging Het
Efcab3 T G 11: 104,911,352 (GRCm39) V4544G probably benign Het
Epb41l1 C A 2: 156,363,591 (GRCm39) T700K probably benign Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Ephb2 C A 4: 136,402,769 (GRCm39) G501C probably benign Het
Erbb3 T C 10: 128,406,030 (GRCm39) Y1129C probably damaging Het
Fbn1 C T 2: 125,212,726 (GRCm39) V799M possibly damaging Het
Fbxo9 G A 9: 77,991,933 (GRCm39) P353S probably benign Het
Ggt1 T G 10: 75,412,056 (GRCm39) V100G probably benign Het
Gm45861 T C 8: 28,032,531 (GRCm39) M885T unknown Het
Grin2d A T 7: 45,483,425 (GRCm39) Y917* probably null Het
Hectd4 T A 5: 121,415,819 (GRCm39) V540D possibly damaging Het
Helz T A 11: 107,495,079 (GRCm39) I351K probably damaging Het
Ighv2-6-8 A G 12: 113,759,980 (GRCm39) V43A probably damaging Het
Igkv9-129 T A 6: 67,817,106 (GRCm39) I70N probably damaging Het
Il18 A T 9: 50,489,178 (GRCm39) D69V probably damaging Het
Kcnh7 T A 2: 62,552,209 (GRCm39) E927D Het
Kcnt2 T A 1: 140,356,587 (GRCm39) V342E probably benign Het
Khdc4 A G 3: 88,607,286 (GRCm39) N330S probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Krt18 C G 15: 101,937,962 (GRCm39) A153G probably damaging Het
Lmntd2 A T 7: 140,791,977 (GRCm39) probably benign Het
Lrrc26 G T 2: 25,180,286 (GRCm39) A96S probably benign Het
Map3k11 A T 19: 5,752,166 (GRCm39) S783C probably damaging Het
Mib2 G A 4: 155,740,729 (GRCm39) L632F possibly damaging Het
Mtr A T 13: 12,250,365 (GRCm39) F339L probably benign Het
Musk T C 4: 58,354,032 (GRCm39) F362L probably benign Het
Ncor1 G A 11: 62,233,871 (GRCm39) Q444* probably null Het
Nek4 T C 14: 30,685,924 (GRCm39) S279P Het
Nell1 C T 7: 50,210,543 (GRCm39) T348I unknown Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nrip1 T C 16: 76,088,902 (GRCm39) H885R probably damaging Het
Or13a19 G A 7: 139,902,938 (GRCm39) G109R possibly damaging Het
Or2a5 T A 6: 42,874,201 (GRCm39) V272D Het
Or2y12 C A 11: 49,426,028 (GRCm39) N5K probably damaging Het
Or6c208 T C 10: 129,224,240 (GRCm39) V246A probably damaging Het
Or6c69c T A 10: 129,910,522 (GRCm39) V81D possibly damaging Het
Or6d14 A G 6: 116,534,255 (GRCm39) T290A possibly damaging Het
Otog A G 7: 45,959,571 (GRCm39) D720G probably damaging Het
P3h3 C A 6: 124,834,564 (GRCm39) Q29H possibly damaging Het
Parn A G 16: 13,466,281 (GRCm39) probably null Het
Pcnt C A 10: 76,245,407 (GRCm39) E1077* probably null Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pigb A G 9: 72,929,576 (GRCm39) W336R probably damaging Het
Pkdrej A T 15: 85,700,538 (GRCm39) S1799R probably damaging Het
Pnpla6 G T 8: 3,567,401 (GRCm39) M86I possibly damaging Het
Prickle2 T C 6: 92,435,620 (GRCm39) K50E possibly damaging Het
Psg21 A G 7: 18,386,389 (GRCm39) V199A probably benign Het
Reep3 T C 10: 66,871,786 (GRCm39) probably null Het
Reln T C 5: 22,104,155 (GRCm39) D3272G probably damaging Het
Rps6ka4 A G 19: 6,808,667 (GRCm39) V526A possibly damaging Het
Sel1l3 T C 5: 53,280,771 (GRCm39) E911G probably damaging Het
Serpinb6b C A 13: 33,162,125 (GRCm39) A308E probably benign Het
Slc26a4 A G 12: 31,572,523 (GRCm39) V746A probably benign Het
Slc4a3 T G 1: 75,527,957 (GRCm39) M402R probably damaging Het
Slc9b1 A T 3: 135,078,900 (GRCm39) T186S possibly damaging Het
Slk A G 19: 47,608,712 (GRCm39) Q555R probably benign Het
Smc2 T A 4: 52,475,100 (GRCm39) D925E probably benign Het
Stat5a A T 11: 100,774,764 (GRCm39) T758S unknown Het
Sulf1 A G 1: 12,906,499 (GRCm39) S514G probably benign Het
Tcp11l1 T A 2: 104,536,853 (GRCm39) N4I probably damaging Het
Tex2 A T 11: 106,402,731 (GRCm39) I1047K unknown Het
Tmem184b A G 15: 79,261,264 (GRCm39) V114A possibly damaging Het
Trmt11 A G 10: 30,467,027 (GRCm39) V95A probably benign Het
Trp53bp2 A G 1: 182,268,433 (GRCm39) D169G possibly damaging Het
Ttc41 T A 10: 86,549,599 (GRCm39) N264K possibly damaging Het
Uba2 A C 7: 33,853,987 (GRCm39) S318R probably benign Het
Wapl T A 14: 34,451,139 (GRCm39) N724K probably damaging Het
Wfdc9 T A 2: 164,493,671 (GRCm39) I5F probably damaging Het
Zan C T 5: 137,406,563 (GRCm39) D3686N unknown Het
Zfp618 A T 4: 63,012,708 (GRCm39) Y140F probably benign Het
Zfp790 A G 7: 29,527,593 (GRCm39) T93A probably benign Het
Zfp979 A C 4: 147,697,984 (GRCm39) F242V probably benign Het
Other mutations in Mical2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Mical2 APN 7 111,981,352 (GRCm39) missense possibly damaging 0.94
IGL00886:Mical2 APN 7 111,914,279 (GRCm39) missense probably benign 0.00
IGL00934:Mical2 APN 7 111,948,610 (GRCm39) missense probably damaging 1.00
IGL00941:Mical2 APN 7 111,920,652 (GRCm39) splice site probably benign
IGL01020:Mical2 APN 7 111,914,283 (GRCm39) splice site probably benign
IGL01395:Mical2 APN 7 111,922,792 (GRCm39) missense probably damaging 1.00
IGL01658:Mical2 APN 7 111,914,205 (GRCm39) missense probably damaging 1.00
IGL01775:Mical2 APN 7 111,981,269 (GRCm39) missense possibly damaging 0.89
IGL02040:Mical2 APN 7 111,910,613 (GRCm39) missense probably damaging 1.00
IGL02051:Mical2 APN 7 111,980,597 (GRCm39) missense probably benign 0.30
IGL02388:Mical2 APN 7 111,934,620 (GRCm39) missense probably benign
IGL02551:Mical2 APN 7 111,923,197 (GRCm39) missense probably benign 0.01
IGL02578:Mical2 APN 7 111,950,580 (GRCm39) missense probably benign 0.05
IGL02751:Mical2 APN 7 111,931,243 (GRCm39) missense probably benign 0.11
IGL03114:Mical2 APN 7 111,996,764 (GRCm39) missense probably damaging 1.00
R0091:Mical2 UTSW 7 111,980,503 (GRCm39) missense probably benign 0.05
R0101:Mical2 UTSW 7 111,936,074 (GRCm39) missense possibly damaging 0.86
R0415:Mical2 UTSW 7 111,980,235 (GRCm39) missense probably damaging 1.00
R0504:Mical2 UTSW 7 111,870,524 (GRCm39) missense probably benign 0.00
R0594:Mical2 UTSW 7 111,917,657 (GRCm39) missense probably damaging 0.97
R0609:Mical2 UTSW 7 111,920,647 (GRCm39) splice site probably null
R0962:Mical2 UTSW 7 111,979,624 (GRCm39) missense probably damaging 0.99
R1521:Mical2 UTSW 7 111,980,817 (GRCm39) missense probably damaging 1.00
R1542:Mical2 UTSW 7 111,908,675 (GRCm39) missense probably damaging 1.00
R1611:Mical2 UTSW 7 111,980,671 (GRCm39) missense probably damaging 0.99
R1740:Mical2 UTSW 7 111,933,043 (GRCm39) missense probably benign
R1815:Mical2 UTSW 7 112,012,109 (GRCm39) missense probably damaging 1.00
R1855:Mical2 UTSW 7 111,944,489 (GRCm39) missense probably benign 0.21
R1958:Mical2 UTSW 7 111,980,311 (GRCm39) missense probably benign 0.00
R1962:Mical2 UTSW 7 112,012,051 (GRCm39) missense probably benign 0.14
R2086:Mical2 UTSW 7 111,917,810 (GRCm39) missense probably benign 0.31
R2136:Mical2 UTSW 7 111,870,722 (GRCm39) missense possibly damaging 0.72
R2418:Mical2 UTSW 7 111,919,941 (GRCm39) critical splice donor site probably null
R2439:Mical2 UTSW 7 111,994,002 (GRCm39) missense probably damaging 0.99
R3053:Mical2 UTSW 7 111,910,630 (GRCm39) missense probably damaging 1.00
R3979:Mical2 UTSW 7 112,006,885 (GRCm39) splice site probably null
R4308:Mical2 UTSW 7 111,931,199 (GRCm39) missense probably benign 0.27
R4551:Mical2 UTSW 7 111,981,123 (GRCm39) missense possibly damaging 0.87
R4583:Mical2 UTSW 7 112,012,154 (GRCm39) missense probably benign 0.02
R4663:Mical2 UTSW 7 111,927,884 (GRCm39) missense possibly damaging 0.80
R4868:Mical2 UTSW 7 111,917,831 (GRCm39) missense probably damaging 1.00
R4902:Mical2 UTSW 7 111,936,107 (GRCm39) missense probably benign
R5112:Mical2 UTSW 7 111,919,818 (GRCm39) missense probably damaging 1.00
R5459:Mical2 UTSW 7 111,981,444 (GRCm39) missense probably benign 0.00
R5487:Mical2 UTSW 7 111,919,842 (GRCm39) missense probably damaging 1.00
R5563:Mical2 UTSW 7 111,914,185 (GRCm39) missense probably damaging 1.00
R5763:Mical2 UTSW 7 111,973,861 (GRCm39) critical splice donor site probably null
R5817:Mical2 UTSW 7 111,922,866 (GRCm39) missense probably benign
R5987:Mical2 UTSW 7 111,934,155 (GRCm39) missense probably benign 0.00
R6042:Mical2 UTSW 7 111,979,619 (GRCm39) missense probably benign 0.40
R6087:Mical2 UTSW 7 111,917,692 (GRCm39) nonsense probably null
R6189:Mical2 UTSW 7 112,012,087 (GRCm39) missense probably damaging 1.00
R6209:Mical2 UTSW 7 111,923,293 (GRCm39) splice site probably null
R6311:Mical2 UTSW 7 111,922,765 (GRCm39) missense probably damaging 1.00
R6319:Mical2 UTSW 7 111,927,884 (GRCm39) missense possibly damaging 0.80
R6578:Mical2 UTSW 7 111,910,652 (GRCm39) missense probably damaging 1.00
R6750:Mical2 UTSW 7 111,981,046 (GRCm39) missense probably damaging 0.98
R6782:Mical2 UTSW 7 111,945,968 (GRCm39) missense probably damaging 1.00
R6798:Mical2 UTSW 7 111,975,266 (GRCm39) utr 3 prime probably benign
R7061:Mical2 UTSW 7 111,946,008 (GRCm39) missense probably benign 0.10
R7147:Mical2 UTSW 7 111,922,810 (GRCm39) missense possibly damaging 0.77
R7260:Mical2 UTSW 7 111,919,001 (GRCm39) missense probably benign 0.10
R7266:Mical2 UTSW 7 111,902,963 (GRCm39) missense probably damaging 1.00
R7347:Mical2 UTSW 7 111,981,358 (GRCm39) missense probably benign 0.01
R7391:Mical2 UTSW 7 111,919,816 (GRCm39) missense probably damaging 1.00
R7724:Mical2 UTSW 7 111,922,833 (GRCm39) missense probably damaging 1.00
R7747:Mical2 UTSW 7 111,933,046 (GRCm39) missense probably benign 0.02
R7783:Mical2 UTSW 7 112,012,183 (GRCm39) missense probably damaging 1.00
R7818:Mical2 UTSW 7 111,944,514 (GRCm39) missense probably damaging 1.00
R7824:Mical2 UTSW 7 112,006,844 (GRCm39) missense probably damaging 1.00
R7995:Mical2 UTSW 7 111,980,975 (GRCm39) missense probably benign 0.31
R8022:Mical2 UTSW 7 111,902,974 (GRCm39) missense probably damaging 1.00
R8429:Mical2 UTSW 7 111,944,460 (GRCm39) missense probably benign 0.01
R8505:Mical2 UTSW 7 111,919,007 (GRCm39) missense probably benign 0.02
R8532:Mical2 UTSW 7 111,917,751 (GRCm39) missense probably damaging 1.00
R8830:Mical2 UTSW 7 111,980,403 (GRCm39) missense probably benign 0.01
R8862:Mical2 UTSW 7 111,910,574 (GRCm39) missense probably damaging 1.00
R8906:Mical2 UTSW 7 111,980,671 (GRCm39) missense probably damaging 0.99
R9006:Mical2 UTSW 7 111,981,323 (GRCm39) missense probably benign 0.13
R9123:Mical2 UTSW 7 111,870,589 (GRCm39) missense possibly damaging 0.61
R9127:Mical2 UTSW 7 111,870,589 (GRCm39) missense possibly damaging 0.61
R9128:Mical2 UTSW 7 111,870,589 (GRCm39) missense possibly damaging 0.61
R9129:Mical2 UTSW 7 111,870,589 (GRCm39) missense possibly damaging 0.61
R9140:Mical2 UTSW 7 112,006,826 (GRCm39) missense probably damaging 1.00
R9187:Mical2 UTSW 7 111,902,797 (GRCm39) nonsense probably null
R9233:Mical2 UTSW 7 111,981,399 (GRCm39) missense probably benign 0.05
R9304:Mical2 UTSW 7 111,980,974 (GRCm39) missense probably damaging 0.97
R9310:Mical2 UTSW 7 111,950,920 (GRCm39) missense probably benign 0.45
R9377:Mical2 UTSW 7 111,981,246 (GRCm39) missense probably benign 0.10
R9399:Mical2 UTSW 7 111,946,082 (GRCm39) missense probably damaging 1.00
R9457:Mical2 UTSW 7 112,010,665 (GRCm39) missense probably damaging 0.96
R9500:Mical2 UTSW 7 111,936,054 (GRCm39) critical splice acceptor site probably null
R9620:Mical2 UTSW 7 111,980,403 (GRCm39) missense probably benign 0.01
R9652:Mical2 UTSW 7 111,945,996 (GRCm39) missense probably damaging 1.00
R9657:Mical2 UTSW 7 111,921,806 (GRCm39) missense probably benign 0.37
R9756:Mical2 UTSW 7 111,902,928 (GRCm39) missense probably damaging 0.99
R9789:Mical2 UTSW 7 111,945,996 (GRCm39) missense probably damaging 1.00
RF008:Mical2 UTSW 7 111,922,833 (GRCm39) missense probably damaging 1.00
X0062:Mical2 UTSW 7 111,946,050 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACTGACGCATCTACCTTTCC -3'
(R):5'- GGAAGCCAACAGGTCTATGAAC -3'

Sequencing Primer
(F):5'- CCTTCTGCAGGCTTCAGGAG -3'
(R):5'- CTGCAGAATGAGATTTGATCCCCAG -3'
Posted On 2021-10-11