Incidental Mutation 'R8988:Ttc41'
ID 684238
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Name tetratricopeptide repeat domain 41
Synonyms Gnn, BC030307
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock # R8988 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 86705811-86776844 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 86713735 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 264 (N264K)
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061458] [ENSMUST00000075632] [ENSMUST00000217747] [ENSMUST00000219108]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000061458
AA Change: N264K

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062844
Gene: ENSMUSG00000044937
AA Change: N264K

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Blast:AAA 336 401 9e-8 BLAST
SCOP:d1jpna2 338 370 1e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000075632
AA Change: N264K

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: N264K

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000217747
AA Change: N264K

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219108
AA Change: N264K

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A G 3: 88,699,979 N330S probably benign Het
Abi2 C T 1: 60,450,092 T291I probably benign Het
Aox1 A C 1: 58,049,466 D137A possibly damaging Het
Apbb2 T C 5: 66,452,101 K68E probably damaging Het
Arf3 A T 15: 98,741,052 M108K probably benign Het
Atg2b T A 12: 105,617,129 I2058F probably damaging Het
Bhlhe40 C T 6: 108,662,557 L99F probably damaging Het
Cyp2b10 G A 7: 25,926,245 R500H probably damaging Het
Dlc1 C T 8: 36,572,843 E937K probably damaging Het
Dll3 A T 7: 28,296,368 V336D possibly damaging Het
Dync2h1 A G 9: 7,037,727 F3377L probably benign Het
Eef1d A G 15: 75,896,311 Y561H probably damaging Het
Epb41l1 C A 2: 156,521,671 T700K probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Ephb2 C A 4: 136,675,458 G501C probably benign Het
Erbb3 T C 10: 128,570,161 Y1129C probably damaging Het
Fbn1 C T 2: 125,370,806 V799M possibly damaging Het
Fbxo9 G A 9: 78,084,651 P353S probably benign Het
Ggt1 T G 10: 75,576,222 V100G probably benign Het
Gm11639 T G 11: 105,020,526 V4544G probably benign Het
Gm45861 T C 8: 27,542,503 M885T unknown Het
Gm609 T C 16: 45,417,908 H294R probably benign Het
Grin2d A T 7: 45,834,001 Y917* probably null Het
Hectd4 T A 5: 121,277,756 V540D possibly damaging Het
Helz T A 11: 107,604,253 I351K probably damaging Het
Ighv2-6-8 A G 12: 113,796,360 V43A probably damaging Het
Igkv9-129 T A 6: 67,840,122 I70N probably damaging Het
Il18 A T 9: 50,577,878 D69V probably damaging Het
Kcnh7 T A 2: 62,721,865 E927D Het
Kcnt2 T A 1: 140,428,849 V342E probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Krt18 C G 15: 102,029,527 A153G probably damaging Het
Lrrc26 G T 2: 25,290,274 A96S probably benign Het
Map3k11 A T 19: 5,702,138 S783C probably damaging Het
Mib2 G A 4: 155,656,272 L632F possibly damaging Het
Mical2 A C 7: 112,311,454 D277A possibly damaging Het
Mtr A T 13: 12,235,479 F339L probably benign Het
Musk T C 4: 58,354,032 F362L probably benign Het
Ncor1 G A 11: 62,343,045 Q444* probably null Het
Nek4 T C 14: 30,963,967 S279P Het
Nell1 C T 7: 50,560,795 T348I unknown Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nrip1 T C 16: 76,292,014 H885R probably damaging Het
Olfr1382 C A 11: 49,535,201 N5K probably damaging Het
Olfr214 A G 6: 116,557,294 T290A possibly damaging Het
Olfr448 T A 6: 42,897,267 V272D Het
Olfr525 G A 7: 140,323,025 G109R possibly damaging Het
Olfr784 T C 10: 129,388,371 V246A probably damaging Het
Olfr822 T A 10: 130,074,653 V81D possibly damaging Het
Otog A G 7: 46,310,147 D720G probably damaging Het
Parn A G 16: 13,648,417 probably null Het
Pcnt C A 10: 76,409,573 E1077* probably null Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pigb A G 9: 73,022,294 W336R probably damaging Het
Pkdrej A T 15: 85,816,337 S1799R probably damaging Het
Pnpla6 G T 8: 3,517,401 M86I possibly damaging Het
Prickle2 T C 6: 92,458,639 K50E possibly damaging Het
Psg21 A G 7: 18,652,464 V199A probably benign Het
Reep3 T C 10: 67,036,007 probably null Het
Reln T C 5: 21,899,157 D3272G probably damaging Het
Rps6ka4 A G 19: 6,831,299 V526A possibly damaging Het
Sel1l3 T C 5: 53,123,429 E911G probably damaging Het
Serpinb6b C A 13: 32,978,142 A308E probably benign Het
Slc26a4 A G 12: 31,522,524 V746A probably benign Het
Slc4a3 T G 1: 75,551,313 M402R probably damaging Het
Slc9b1 A T 3: 135,373,139 T186S possibly damaging Het
Slk A G 19: 47,620,273 Q555R probably benign Het
Smc2 T A 4: 52,475,100 D925E probably benign Het
Stat5a A T 11: 100,883,938 T758S unknown Het
Sulf1 A G 1: 12,836,275 S514G probably benign Het
Tcp11l1 T A 2: 104,706,508 N4I probably damaging Het
Tex2 A T 11: 106,511,905 I1047K unknown Het
Tmem184b A G 15: 79,377,064 V114A possibly damaging Het
Trmt11 A G 10: 30,591,031 V95A probably benign Het
Trp53bp2 A G 1: 182,440,868 D169G possibly damaging Het
Uba2 A C 7: 34,154,562 S318R probably benign Het
Wapl T A 14: 34,729,182 N724K probably damaging Het
Wfdc9 T A 2: 164,651,751 I5F probably damaging Het
Zan C T 5: 137,408,301 D3686N unknown Het
Zfp618 A T 4: 63,094,471 Y140F probably benign Het
Zfp790 A G 7: 29,828,168 T93A probably benign Het
Zfp979 A C 4: 147,613,527 F242V probably benign Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86736933 missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86775957 missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86776678 missense probably benign
IGL01707:Ttc41 APN 10 86776767 missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86731026 missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86776624 missense probably benign 0.03
IGL01918:Ttc41 APN 10 86713190 missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86775951 missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86760914 nonsense probably null
IGL02887:Ttc41 APN 10 86733654 missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86736857 missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86758348 missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86724414 critical splice donor site probably null
IGL03242:Ttc41 APN 10 86776819 makesense probably null
IGL03307:Ttc41 APN 10 86744440 missense possibly damaging 0.76
BB003:Ttc41 UTSW 10 86776047 missense probably benign 0.10
BB013:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0379:Ttc41 UTSW 10 86712977 missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86763947 missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86759097 missense probably benign 0.00
R1589:Ttc41 UTSW 10 86776390 missense probably benign 0.01
R1599:Ttc41 UTSW 10 86776573 missense probably benign 0.04
R1608:Ttc41 UTSW 10 86775993 missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86776252 missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86776214 missense probably benign
R2398:Ttc41 UTSW 10 86713386 missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86724374 missense probably benign 0.42
R3117:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86729798 missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4841:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4842:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4884:Ttc41 UTSW 10 86731018 missense probably benign 0.00
R4885:Ttc41 UTSW 10 86759102 missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86776192 missense possibly damaging 0.80
R5067:Ttc41 UTSW 10 86744544 missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86730942 missense probably benign 0.13
R5268:Ttc41 UTSW 10 86744478 missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86776579 missense probably benign 0.04
R5301:Ttc41 UTSW 10 86719520 missense probably benign 0.00
R5425:Ttc41 UTSW 10 86776630 missense probably damaging 0.96
R5567:Ttc41 UTSW 10 86760920 critical splice donor site probably null
R5635:Ttc41 UTSW 10 86736977 missense probably benign 0.09
R5752:Ttc41 UTSW 10 86758346 missense probably benign 0.33
R5868:Ttc41 UTSW 10 86750264 missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86713224 missense probably damaging 1.00
R6116:Ttc41 UTSW 10 86759088 critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86776663 missense probably benign 0.00
R6260:Ttc41 UTSW 10 86731159 missense probably benign 0.20
R6260:Ttc41 UTSW 10 86733707 missense probably benign 0.32
R6276:Ttc41 UTSW 10 86744449 missense probably benign 0.01
R6458:Ttc41 UTSW 10 86758270 missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86713503 missense probably benign 0.17
R7348:Ttc41 UTSW 10 86750348 nonsense probably null
R7382:Ttc41 UTSW 10 86776510 missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86713432 missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86759224 missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86776631 missense probably benign 0.02
R7926:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R7998:Ttc41 UTSW 10 86736847 missense probably benign 0.01
R8021:Ttc41 UTSW 10 86733714 missense probably benign
R8059:Ttc41 UTSW 10 86712978 missense probably benign 0.01
R8170:Ttc41 UTSW 10 86776166 missense probably damaging 1.00
R8303:Ttc41 UTSW 10 86719630 missense probably benign 0.06
R8375:Ttc41 UTSW 10 86763980 missense probably damaging 0.97
R8383:Ttc41 UTSW 10 86719526 missense probably benign 0.00
R8698:Ttc41 UTSW 10 86712977 missense probably benign 0.00
R8773:Ttc41 UTSW 10 86729815 missense probably benign 0.35
R8902:Ttc41 UTSW 10 86713001 missense probably benign 0.06
R8985:Ttc41 UTSW 10 86731092 missense possibly damaging 0.80
R9007:Ttc41 UTSW 10 86733761 missense probably damaging 1.00
R9137:Ttc41 UTSW 10 86776622 missense probably benign 0.22
R9236:Ttc41 UTSW 10 86776730 missense probably damaging 1.00
R9248:Ttc41 UTSW 10 86731249 missense probably benign 0.00
R9287:Ttc41 UTSW 10 86763966 missense probably benign 0.43
R9345:Ttc41 UTSW 10 86759225 missense probably damaging 0.99
R9386:Ttc41 UTSW 10 86713026 missense probably damaging 0.99
X0024:Ttc41 UTSW 10 86724250 missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86729797 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCTCAGCATATCTGTTGAACGAAC -3'
(R):5'- CTAGAGAAACAGGAGTGGCC -3'

Sequencing Primer
(F):5'- TGTTGAACGAACAGGGGAAGATG -3'
(R):5'- AAAAGTTGTCCTCTGTCCTCCAAAG -3'
Posted On 2021-10-11