Incidental Mutation 'R8988:Serpinb6b'
ID 684252
Institutional Source Beutler Lab
Gene Symbol Serpinb6b
Ensembl Gene ENSMUSG00000042842
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 6b
Synonyms NK13, ovalbumin, Spi12
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock # R8988 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 32965209-32979067 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 32978142 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 308 (A308E)
Ref Sequence ENSEMBL: ENSMUSP00000105922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017184] [ENSMUST00000110293] [ENSMUST00000164541]
AlphaFold O08804
Predicted Effect probably benign
Transcript: ENSMUST00000017184
SMART Domains Protein: ENSMUSP00000017184
Gene: ENSMUSG00000042842

DomainStartEndE-ValueType
SERPIN 13 208 1.22e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110293
AA Change: A308E

PolyPhen 2 Score 0.452 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105922
Gene: ENSMUSG00000042842
AA Change: A308E

DomainStartEndE-ValueType
SERPIN 13 377 1.99e-174 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164541
AA Change: A189E

PolyPhen 2 Score 0.452 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A G 3: 88,699,979 N330S probably benign Het
Abi2 C T 1: 60,450,092 T291I probably benign Het
Aox1 A C 1: 58,049,466 D137A possibly damaging Het
Apbb2 T C 5: 66,452,101 K68E probably damaging Het
Arf3 A T 15: 98,741,052 M108K probably benign Het
Atg2b T A 12: 105,617,129 I2058F probably damaging Het
Bhlhe40 C T 6: 108,662,557 L99F probably damaging Het
Cyp2b10 G A 7: 25,926,245 R500H probably damaging Het
Dlc1 C T 8: 36,572,843 E937K probably damaging Het
Dll3 A T 7: 28,296,368 V336D possibly damaging Het
Dync2h1 A G 9: 7,037,727 F3377L probably benign Het
Eef1d A G 15: 75,896,311 Y561H probably damaging Het
Epb41l1 C A 2: 156,521,671 T700K probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Ephb2 C A 4: 136,675,458 G501C probably benign Het
Erbb3 T C 10: 128,570,161 Y1129C probably damaging Het
Fbn1 C T 2: 125,370,806 V799M possibly damaging Het
Fbxo9 G A 9: 78,084,651 P353S probably benign Het
Ggt1 T G 10: 75,576,222 V100G probably benign Het
Gm11639 T G 11: 105,020,526 V4544G probably benign Het
Gm45861 T C 8: 27,542,503 M885T unknown Het
Gm609 T C 16: 45,417,908 H294R probably benign Het
Grin2d A T 7: 45,834,001 Y917* probably null Het
Hectd4 T A 5: 121,277,756 V540D possibly damaging Het
Helz T A 11: 107,604,253 I351K probably damaging Het
Ighv2-6-8 A G 12: 113,796,360 V43A probably damaging Het
Igkv9-129 T A 6: 67,840,122 I70N probably damaging Het
Il18 A T 9: 50,577,878 D69V probably damaging Het
Kcnh7 T A 2: 62,721,865 E927D Het
Kcnt2 T A 1: 140,428,849 V342E probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Krt18 C G 15: 102,029,527 A153G probably damaging Het
Lrrc26 G T 2: 25,290,274 A96S probably benign Het
Map3k11 A T 19: 5,702,138 S783C probably damaging Het
Mib2 G A 4: 155,656,272 L632F possibly damaging Het
Mical2 A C 7: 112,311,454 D277A possibly damaging Het
Mtr A T 13: 12,235,479 F339L probably benign Het
Musk T C 4: 58,354,032 F362L probably benign Het
Ncor1 G A 11: 62,343,045 Q444* probably null Het
Nek4 T C 14: 30,963,967 S279P Het
Nell1 C T 7: 50,560,795 T348I unknown Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nrip1 T C 16: 76,292,014 H885R probably damaging Het
Olfr1382 C A 11: 49,535,201 N5K probably damaging Het
Olfr214 A G 6: 116,557,294 T290A possibly damaging Het
Olfr448 T A 6: 42,897,267 V272D Het
Olfr525 G A 7: 140,323,025 G109R possibly damaging Het
Olfr784 T C 10: 129,388,371 V246A probably damaging Het
Olfr822 T A 10: 130,074,653 V81D possibly damaging Het
Otog A G 7: 46,310,147 D720G probably damaging Het
Parn A G 16: 13,648,417 probably null Het
Pcnt C A 10: 76,409,573 E1077* probably null Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pigb A G 9: 73,022,294 W336R probably damaging Het
Pkdrej A T 15: 85,816,337 S1799R probably damaging Het
Pnpla6 G T 8: 3,517,401 M86I possibly damaging Het
Prickle2 T C 6: 92,458,639 K50E possibly damaging Het
Psg21 A G 7: 18,652,464 V199A probably benign Het
Reep3 T C 10: 67,036,007 probably null Het
Reln T C 5: 21,899,157 D3272G probably damaging Het
Rps6ka4 A G 19: 6,831,299 V526A possibly damaging Het
Sel1l3 T C 5: 53,123,429 E911G probably damaging Het
Slc26a4 A G 12: 31,522,524 V746A probably benign Het
Slc4a3 T G 1: 75,551,313 M402R probably damaging Het
Slc9b1 A T 3: 135,373,139 T186S possibly damaging Het
Slk A G 19: 47,620,273 Q555R probably benign Het
Smc2 T A 4: 52,475,100 D925E probably benign Het
Stat5a A T 11: 100,883,938 T758S unknown Het
Sulf1 A G 1: 12,836,275 S514G probably benign Het
Tcp11l1 T A 2: 104,706,508 N4I probably damaging Het
Tex2 A T 11: 106,511,905 I1047K unknown Het
Tmem184b A G 15: 79,377,064 V114A possibly damaging Het
Trmt11 A G 10: 30,591,031 V95A probably benign Het
Trp53bp2 A G 1: 182,440,868 D169G possibly damaging Het
Ttc41 T A 10: 86,713,735 N264K possibly damaging Het
Uba2 A C 7: 34,154,562 S318R probably benign Het
Wapl T A 14: 34,729,182 N724K probably damaging Het
Wfdc9 T A 2: 164,651,751 I5F probably damaging Het
Zan C T 5: 137,408,301 D3686N unknown Het
Zfp618 A T 4: 63,094,471 Y140F probably benign Het
Zfp790 A G 7: 29,828,168 T93A probably benign Het
Zfp979 A C 4: 147,613,527 F242V probably benign Het
Other mutations in Serpinb6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Serpinb6b APN 13 32971546 missense probably benign 0.01
IGL01077:Serpinb6b APN 13 32978066 missense possibly damaging 0.68
IGL01553:Serpinb6b APN 13 32974948 missense probably damaging 1.00
IGL02981:Serpinb6b APN 13 32971606 missense probably benign 0.34
R0308:Serpinb6b UTSW 13 32978237 missense probably benign 0.09
R1568:Serpinb6b UTSW 13 32974912 missense probably damaging 1.00
R1692:Serpinb6b UTSW 13 32974995 missense probably damaging 1.00
R1763:Serpinb6b UTSW 13 32978058 missense probably damaging 1.00
R1917:Serpinb6b UTSW 13 32978240 missense probably benign
R1918:Serpinb6b UTSW 13 32978240 missense probably benign
R1919:Serpinb6b UTSW 13 32978240 missense probably benign
R1920:Serpinb6b UTSW 13 32975008 missense possibly damaging 0.47
R3032:Serpinb6b UTSW 13 32968568 missense possibly damaging 0.78
R4239:Serpinb6b UTSW 13 32972263 missense probably damaging 0.96
R5089:Serpinb6b UTSW 13 32978150 missense probably benign
R5503:Serpinb6b UTSW 13 32977659 missense possibly damaging 0.95
R5540:Serpinb6b UTSW 13 32977558 nonsense probably null
R6061:Serpinb6b UTSW 13 32977994 missense probably damaging 0.99
R6253:Serpinb6b UTSW 13 32972272 missense probably damaging 1.00
R7156:Serpinb6b UTSW 13 32971615 missense probably benign 0.09
R7248:Serpinb6b UTSW 13 32977576 missense probably benign 0.23
R7315:Serpinb6b UTSW 13 32972257 missense probably benign 0.41
R7424:Serpinb6b UTSW 13 32968667 missense probably damaging 0.99
R7547:Serpinb6b UTSW 13 32974924 missense probably benign 0.05
R7732:Serpinb6b UTSW 13 32968607 missense probably damaging 1.00
R7770:Serpinb6b UTSW 13 32977529 missense probably benign 0.05
R7802:Serpinb6b UTSW 13 32971596
R8814:Serpinb6b UTSW 13 32978304 missense possibly damaging 0.94
R8966:Serpinb6b UTSW 13 32978052 missense probably damaging 1.00
R9037:Serpinb6b UTSW 13 32978015 nonsense probably null
R9129:Serpinb6b UTSW 13 32978156 small deletion probably benign
R9377:Serpinb6b UTSW 13 32968511 start codon destroyed probably null 1.00
R9415:Serpinb6b UTSW 13 32975019 missense
Predicted Primers PCR Primer
(F):5'- TGACCTAAGATCTTGAACTGTCTTC -3'
(R):5'- ACACAATCCCACTGGTCCTG -3'

Sequencing Primer
(F):5'- CTTGAACTGTCTTCTAGGTGGAAAAG -3'
(R):5'- TCCTGCTGTGTTGGATGAAGAAAAG -3'
Posted On 2021-10-11