Incidental Mutation 'R8988:Wapl'
ID 684254
Institutional Source Beutler Lab
Gene Symbol Wapl
Ensembl Gene ENSMUSG00000041408
Gene Name WAPL cohesin release factor
Synonyms A530089A20Rik, Wapal
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8988 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 34673928-34747983 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34729182 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 724 (N724K)
Ref Sequence ENSEMBL: ENSMUSP00000040232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]
AlphaFold Q65Z40
Predicted Effect probably damaging
Transcript: ENSMUST00000048263
AA Change: N724K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: N724K

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 645 1009 6.5e-153 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090027
AA Change: N718K

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: N718K

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 639 1003 2.6e-153 PFAM
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000117282
Gene: ENSMUSG00000041408
AA Change: N8K

DomainStartEndE-ValueType
Pfam:WAPL 1 281 1.1e-78 PFAM
coiled coil region 329 351 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169910
AA Change: N724K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: N724K

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 647 1008 3.5e-120 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A G 3: 88,699,979 N330S probably benign Het
Abi2 C T 1: 60,450,092 T291I probably benign Het
Aox1 A C 1: 58,049,466 D137A possibly damaging Het
Apbb2 T C 5: 66,452,101 K68E probably damaging Het
Arf3 A T 15: 98,741,052 M108K probably benign Het
Atg2b T A 12: 105,617,129 I2058F probably damaging Het
Bhlhe40 C T 6: 108,662,557 L99F probably damaging Het
Cyp2b10 G A 7: 25,926,245 R500H probably damaging Het
Dlc1 C T 8: 36,572,843 E937K probably damaging Het
Dll3 A T 7: 28,296,368 V336D possibly damaging Het
Dync2h1 A G 9: 7,037,727 F3377L probably benign Het
Eef1d A G 15: 75,896,311 Y561H probably damaging Het
Epb41l1 C A 2: 156,521,671 T700K probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Ephb2 C A 4: 136,675,458 G501C probably benign Het
Erbb3 T C 10: 128,570,161 Y1129C probably damaging Het
Fbn1 C T 2: 125,370,806 V799M possibly damaging Het
Fbxo9 G A 9: 78,084,651 P353S probably benign Het
Ggt1 T G 10: 75,576,222 V100G probably benign Het
Gm11639 T G 11: 105,020,526 V4544G probably benign Het
Gm45861 T C 8: 27,542,503 M885T unknown Het
Gm609 T C 16: 45,417,908 H294R probably benign Het
Grin2d A T 7: 45,834,001 Y917* probably null Het
Hectd4 T A 5: 121,277,756 V540D possibly damaging Het
Helz T A 11: 107,604,253 I351K probably damaging Het
Ighv2-6-8 A G 12: 113,796,360 V43A probably damaging Het
Igkv9-129 T A 6: 67,840,122 I70N probably damaging Het
Il18 A T 9: 50,577,878 D69V probably damaging Het
Kcnh7 T A 2: 62,721,865 E927D Het
Kcnt2 T A 1: 140,428,849 V342E probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Krt18 C G 15: 102,029,527 A153G probably damaging Het
Lmntd2 A T 7: 141,212,064 probably benign Het
Lrrc26 G T 2: 25,290,274 A96S probably benign Het
Map3k11 A T 19: 5,702,138 S783C probably damaging Het
Mib2 G A 4: 155,656,272 L632F possibly damaging Het
Mical2 A C 7: 112,311,454 D277A possibly damaging Het
Mtr A T 13: 12,235,479 F339L probably benign Het
Musk T C 4: 58,354,032 F362L probably benign Het
Ncor1 G A 11: 62,343,045 Q444* probably null Het
Nek4 T C 14: 30,963,967 S279P Het
Nell1 C T 7: 50,560,795 T348I unknown Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nrip1 T C 16: 76,292,014 H885R probably damaging Het
Olfr1382 C A 11: 49,535,201 N5K probably damaging Het
Olfr214 A G 6: 116,557,294 T290A possibly damaging Het
Olfr448 T A 6: 42,897,267 V272D Het
Olfr525 G A 7: 140,323,025 G109R possibly damaging Het
Olfr784 T C 10: 129,388,371 V246A probably damaging Het
Olfr822 T A 10: 130,074,653 V81D possibly damaging Het
Otog A G 7: 46,310,147 D720G probably damaging Het
P3h3 C A 6: 124,857,601 Q29H possibly damaging Het
Parn A G 16: 13,648,417 probably null Het
Pcnt C A 10: 76,409,573 E1077* probably null Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pigb A G 9: 73,022,294 W336R probably damaging Het
Pkdrej A T 15: 85,816,337 S1799R probably damaging Het
Pnpla6 G T 8: 3,517,401 M86I possibly damaging Het
Prickle2 T C 6: 92,458,639 K50E possibly damaging Het
Psg21 A G 7: 18,652,464 V199A probably benign Het
Reep3 T C 10: 67,036,007 probably null Het
Reln T C 5: 21,899,157 D3272G probably damaging Het
Rps6ka4 A G 19: 6,831,299 V526A possibly damaging Het
Sel1l3 T C 5: 53,123,429 E911G probably damaging Het
Serpinb6b C A 13: 32,978,142 A308E probably benign Het
Slc26a4 A G 12: 31,522,524 V746A probably benign Het
Slc4a3 T G 1: 75,551,313 M402R probably damaging Het
Slc9b1 A T 3: 135,373,139 T186S possibly damaging Het
Slk A G 19: 47,620,273 Q555R probably benign Het
Smc2 T A 4: 52,475,100 D925E probably benign Het
Stat5a A T 11: 100,883,938 T758S unknown Het
Sulf1 A G 1: 12,836,275 S514G probably benign Het
Tcp11l1 T A 2: 104,706,508 N4I probably damaging Het
Tex2 A T 11: 106,511,905 I1047K unknown Het
Tmem184b A G 15: 79,377,064 V114A possibly damaging Het
Trmt11 A G 10: 30,591,031 V95A probably benign Het
Trp53bp2 A G 1: 182,440,868 D169G possibly damaging Het
Ttc41 T A 10: 86,713,735 N264K possibly damaging Het
Uba2 A C 7: 34,154,562 S318R probably benign Het
Wfdc9 T A 2: 164,651,751 I5F probably damaging Het
Zan C T 5: 137,408,301 D3686N unknown Het
Zfp618 A T 4: 63,094,471 Y140F probably benign Het
Zfp790 A G 7: 29,828,168 T93A probably benign Het
Zfp979 A C 4: 147,613,527 F242V probably benign Het
Other mutations in Wapl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wapl APN 14 34692636 missense probably benign 0.00
IGL00539:Wapl APN 14 34695008 missense probably damaging 1.00
IGL00846:Wapl APN 14 34692744 splice site probably benign
IGL01070:Wapl APN 14 34745622 unclassified probably benign
IGL01516:Wapl APN 14 34692081 missense probably damaging 1.00
IGL02021:Wapl APN 14 34722336 missense probably benign
IGL02209:Wapl APN 14 34677261 missense possibly damaging 0.46
IGL02309:Wapl APN 14 34744863 missense probably damaging 0.98
IGL02471:Wapl APN 14 34691920 missense possibly damaging 0.68
IGL02965:Wapl APN 14 34739224 intron probably benign
IGL03076:Wapl APN 14 34692089 missense probably benign 0.26
IGL03197:Wapl APN 14 34745631 missense possibly damaging 0.77
Mcclintock UTSW 14 34730662 critical splice donor site probably null
Tatum UTSW 14 34729195 missense probably damaging 1.00
R0045:Wapl UTSW 14 34733794 missense probably benign 0.18
R0278:Wapl UTSW 14 34692612 missense possibly damaging 0.68
R0335:Wapl UTSW 14 34692324 missense probably damaging 0.99
R1018:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R1295:Wapl UTSW 14 34724769 missense probably damaging 1.00
R1553:Wapl UTSW 14 34729190 missense probably damaging 1.00
R1868:Wapl UTSW 14 34692458 missense probably benign 0.00
R1909:Wapl UTSW 14 34691912 missense probably damaging 1.00
R2698:Wapl UTSW 14 34691777 missense probably benign
R2990:Wapl UTSW 14 34736708 missense probably damaging 0.98
R3121:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3122:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3147:Wapl UTSW 14 34725149 missense probably damaging 1.00
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3733:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3878:Wapl UTSW 14 34692147 missense probably damaging 1.00
R4034:Wapl UTSW 14 34737914 missense possibly damaging 0.92
R4934:Wapl UTSW 14 34692095 missense probably benign 0.11
R5079:Wapl UTSW 14 34724757 missense probably damaging 1.00
R5104:Wapl UTSW 14 34692059 nonsense probably null
R5113:Wapl UTSW 14 34724754 missense probably damaging 1.00
R5121:Wapl UTSW 14 34677162 missense probably benign 0.01
R5222:Wapl UTSW 14 34736685 nonsense probably null
R5299:Wapl UTSW 14 34733808 critical splice donor site probably null
R5387:Wapl UTSW 14 34677295 missense probably benign 0.00
R5541:Wapl UTSW 14 34730662 critical splice donor site probably null
R5618:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R5802:Wapl UTSW 14 34692320 missense probably damaging 1.00
R6029:Wapl UTSW 14 34739247 missense possibly damaging 0.94
R6292:Wapl UTSW 14 34729195 missense probably damaging 1.00
R6482:Wapl UTSW 14 34692692 missense probably benign 0.01
R6487:Wapl UTSW 14 34692292 missense probably damaging 1.00
R6925:Wapl UTSW 14 34677363 missense probably benign 0.31
R6937:Wapl UTSW 14 34722354 missense probably benign 0.01
R7080:Wapl UTSW 14 34692356 missense probably benign 0.03
R7203:Wapl UTSW 14 34736691 missense probably benign
R7944:Wapl UTSW 14 34677148 missense probably benign 0.00
R7945:Wapl UTSW 14 34677148 missense probably benign 0.00
R7969:Wapl UTSW 14 34730647 missense probably damaging 1.00
R8038:Wapl UTSW 14 34691682 missense probably benign
R8053:Wapl UTSW 14 34692321 missense probably damaging 1.00
R8688:Wapl UTSW 14 34692592 missense possibly damaging 0.94
R8864:Wapl UTSW 14 34692202 missense probably benign 0.03
R9072:Wapl UTSW 14 34677460 missense possibly damaging 0.81
R9197:Wapl UTSW 14 34722287 missense probably damaging 1.00
R9259:Wapl UTSW 14 34741095 missense probably benign 0.00
R9545:Wapl UTSW 14 34677093 missense probably damaging 1.00
R9613:Wapl UTSW 14 34731563 missense probably benign 0.29
R9624:Wapl UTSW 14 34692106 missense possibly damaging 0.89
Z1177:Wapl UTSW 14 34745690 makesense probably null
Predicted Primers PCR Primer
(F):5'- CTGTTCAAAGAAATGGGTAGCG -3'
(R):5'- CACAGTTTCACAGAGTCTTCGG -3'

Sequencing Primer
(F):5'- CAAATAGCTATGTTTCCCTAGGC -3'
(R):5'- ACAGAGTCTTCGGATCTTTTCTTTG -3'
Posted On 2021-10-11