Incidental Mutation 'R8989:Insrr'
ID 684270
Institutional Source Beutler Lab
Gene Symbol Insrr
Ensembl Gene ENSMUSG00000005640
Gene Name insulin receptor-related receptor
Synonyms
MMRRC Submission 068821-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.299) question?
Stock # R8989 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 87796951-87816101 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 87815357 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 1295 (N1295K)
Ref Sequence ENSEMBL: ENSMUSP00000029711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029711] [ENSMUST00000029714] [ENSMUST00000090981] [ENSMUST00000107582]
AlphaFold Q9WTL4
Predicted Effect probably damaging
Transcript: ENSMUST00000029711
AA Change: N1295K

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029711
Gene: ENSMUSG00000005640
AA Change: N1295K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 1.8e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 3.8e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029714
SMART Domains Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090981
SMART Domains Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107582
AA Change: N1295K

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103208
Gene: ENSMUSG00000005640
AA Change: N1295K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 7.7e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 1.6e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Meta Mutation Damage Score 0.0662 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no anomalies in pancreatic islet morphology, beta-cell mass or pancreatic secretory function. This mutation in combination with Insr mutant mice does not affect the diabetes predisposition of Insr mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik T C 19: 58,787,721 E100G probably damaging Het
2210408I21Rik A G 13: 77,612,605 I1260M probably benign Het
4931406P16Rik T C 7: 34,257,444 Q332R probably damaging Het
A1cf T A 19: 31,927,156 F273Y possibly damaging Het
A3galt2 T C 4: 128,761,438 W45R probably damaging Het
Adam23 A G 1: 63,549,789 E460G probably damaging Het
Ago1 T A 4: 126,463,790 T31S probably benign Het
Ago3 T A 4: 126,404,398 T110S probably damaging Het
Akap6 T C 12: 52,880,871 F188S probably damaging Het
Armc4 T C 18: 7,268,464 K352E probably benign Het
Asic2 G A 11: 81,152,354 P38S probably benign Het
Astn2 A T 4: 65,581,653 C1000S possibly damaging Het
Atp10b T A 11: 43,245,442 C1132* probably null Het
Atp7b A T 8: 22,020,895 S527T probably benign Het
Bod1l G A 5: 41,821,682 T763I probably benign Het
Capn11 A G 17: 45,643,857 L118P probably damaging Het
Col13a1 T C 10: 61,860,471 E589G unknown Het
Col6a2 T C 10: 76,604,181 D630G probably damaging Het
Ctnnd2 G A 15: 30,669,514 R423H probably damaging Het
Dld G A 12: 31,333,459 T447I probably damaging Het
Eif4g3 T C 4: 138,184,748 L1227S probably damaging Het
Elac1 C A 18: 73,747,239 E29* probably null Het
Ephb6 C T 6: 41,613,359 A15V probably benign Het
Fam189a2 T A 19: 23,984,832 Q269L probably damaging Het
Fancc G T 13: 63,400,276 L70M possibly damaging Het
Fgd6 T A 10: 94,123,563 M1041K probably damaging Het
Fn1 A G 1: 71,624,287 V1014A possibly damaging Het
Galnt1 C T 18: 24,269,510 T308I possibly damaging Het
Gm13101 C A 4: 143,965,200 A318S probably benign Het
Gpr63 T A 4: 25,007,357 V27D possibly damaging Het
Hcfc2 T C 10: 82,700,988 V78A probably damaging Het
Hexdc T A 11: 121,218,310 probably benign Het
Hipk1 T C 3: 103,761,644 T479A possibly damaging Het
Hkdc1 T C 10: 62,393,765 D711G probably damaging Het
Ifna16 A T 4: 88,676,675 F61Y probably damaging Het
Kif5b T A 18: 6,209,021 R914W probably damaging Het
Lpo T C 11: 87,817,834 T113A probably benign Het
Mmp21 T C 7: 133,675,017 D419G probably damaging Het
Naf1 A G 8: 66,860,976 T204A possibly damaging Het
Nsmce4a T C 7: 130,539,857 T201A probably benign Het
Nup160 T A 2: 90,717,864 N980K probably damaging Het
Olfr113 A T 17: 37,574,651 F257L probably benign Het
Olfr159 T C 4: 43,770,346 I222V possibly damaging Het
Olfr709-ps1 T A 7: 106,927,159 Q100L probably damaging Het
Pcdhb19 A G 18: 37,498,423 T424A probably benign Het
Pclo C T 5: 14,669,311 A1154V unknown Het
Psma8 T A 18: 14,757,347 D181E probably benign Het
Rhpn2 C A 7: 35,354,021 probably benign Het
Serpinb6e G T 13: 33,838,984 H139N possibly damaging Het
Slc26a7 T A 4: 14,533,642 I394F probably damaging Het
Stxbp5l ATTTT ATTTTT 16: 37,216,052 probably null Het
Taok3 T C 5: 117,241,162 S421P probably benign Het
Tas2r143 T G 6: 42,400,894 D219E probably damaging Het
Tcaf1 G A 6: 42,686,773 R58C probably damaging Het
Tenm3 A T 8: 48,235,348 Y2401* probably null Het
Tut1 T C 19: 8,959,752 V200A possibly damaging Het
Unc5c T A 3: 141,803,706 probably benign Het
Vmn2r28 T G 7: 5,490,474 I158L probably benign Het
Vmn2r72 T A 7: 85,754,926 H19L probably benign Het
Xpo4 A G 14: 57,591,018 M795T probably benign Het
Zc3h12a C A 4: 125,120,950 R247L probably damaging Het
Zfp521 C A 18: 13,846,080 L425F probably damaging Het
Other mutations in Insrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Insrr APN 3 87813674 critical splice donor site probably null
IGL00801:Insrr APN 3 87813808 missense probably damaging 1.00
IGL01628:Insrr APN 3 87800792 nonsense probably null
IGL01755:Insrr APN 3 87814186 missense probably damaging 1.00
IGL02100:Insrr APN 3 87811620 missense probably damaging 1.00
IGL02261:Insrr APN 3 87800722 missense probably damaging 1.00
IGL02366:Insrr APN 3 87809909 missense possibly damaging 0.91
IGL02387:Insrr APN 3 87813127 missense probably damaging 1.00
IGL02478:Insrr APN 3 87809412 missense probably benign 0.14
IGL02550:Insrr APN 3 87804498 missense probably damaging 1.00
IGL02555:Insrr APN 3 87813817 missense probably damaging 0.99
IGL02673:Insrr APN 3 87813061 missense possibly damaging 0.95
IGL02724:Insrr APN 3 87809572 missense probably benign 0.31
IGL02798:Insrr APN 3 87810517 missense probably damaging 1.00
IGL02969:Insrr APN 3 87814191 nonsense probably null
IGL03073:Insrr APN 3 87809938 splice site probably benign
IGL03178:Insrr APN 3 87802541 splice site probably null
IGL03389:Insrr APN 3 87808731 missense probably damaging 1.00
IGL03399:Insrr APN 3 87809331 missense probably null 0.99
IGL02799:Insrr UTSW 3 87813581 missense probably damaging 1.00
R0011:Insrr UTSW 3 87809616 missense possibly damaging 0.86
R0053:Insrr UTSW 3 87800452 missense probably damaging 1.00
R0053:Insrr UTSW 3 87800452 missense probably damaging 1.00
R0357:Insrr UTSW 3 87808646 splice site probably null
R0501:Insrr UTSW 3 87810684 missense probably benign 0.12
R0504:Insrr UTSW 3 87813156 missense possibly damaging 0.69
R0522:Insrr UTSW 3 87800872 missense probably damaging 1.00
R0555:Insrr UTSW 3 87814437 splice site probably benign
R0558:Insrr UTSW 3 87810981 missense possibly damaging 0.77
R0599:Insrr UTSW 3 87813133 missense probably damaging 0.97
R1312:Insrr UTSW 3 87800490 missense probably damaging 1.00
R1694:Insrr UTSW 3 87804062 missense probably benign
R1785:Insrr UTSW 3 87810572 splice site probably null
R1786:Insrr UTSW 3 87810572 splice site probably null
R1892:Insrr UTSW 3 87813877 missense probably damaging 1.00
R1950:Insrr UTSW 3 87814513 missense probably damaging 1.00
R2080:Insrr UTSW 3 87814291 missense possibly damaging 0.79
R2094:Insrr UTSW 3 87803181 missense probably damaging 1.00
R2130:Insrr UTSW 3 87810572 splice site probably null
R2131:Insrr UTSW 3 87810572 splice site probably null
R2133:Insrr UTSW 3 87810572 splice site probably null
R2220:Insrr UTSW 3 87809418 missense probably damaging 1.00
R2259:Insrr UTSW 3 87800452 missense probably damaging 1.00
R2404:Insrr UTSW 3 87802667 missense possibly damaging 0.71
R4027:Insrr UTSW 3 87809599 missense probably benign
R4042:Insrr UTSW 3 87813827 missense probably damaging 1.00
R4510:Insrr UTSW 3 87808671 missense possibly damaging 0.67
R4511:Insrr UTSW 3 87808671 missense possibly damaging 0.67
R4571:Insrr UTSW 3 87800887 missense probably benign
R4870:Insrr UTSW 3 87811604 missense probably damaging 1.00
R5057:Insrr UTSW 3 87815265 missense probably benign 0.00
R5393:Insrr UTSW 3 87810700 splice site probably null
R5685:Insrr UTSW 3 87800496 splice site probably null
R6039:Insrr UTSW 3 87809301 missense possibly damaging 0.56
R6039:Insrr UTSW 3 87809301 missense possibly damaging 0.56
R6047:Insrr UTSW 3 87804176 missense probably damaging 1.00
R6276:Insrr UTSW 3 87800519 nonsense probably null
R6298:Insrr UTSW 3 87812965 missense probably damaging 1.00
R6726:Insrr UTSW 3 87813566 missense probably damaging 1.00
R6727:Insrr UTSW 3 87813566 missense probably damaging 1.00
R6728:Insrr UTSW 3 87813566 missense probably damaging 1.00
R6796:Insrr UTSW 3 87813566 missense probably damaging 1.00
R7041:Insrr UTSW 3 87815244 missense probably damaging 1.00
R7169:Insrr UTSW 3 87808594 missense probably benign 0.15
R7270:Insrr UTSW 3 87803133 missense probably damaging 1.00
R7340:Insrr UTSW 3 87814316 critical splice donor site probably null
R7398:Insrr UTSW 3 87808732 missense probably damaging 1.00
R7473:Insrr UTSW 3 87804531 splice site probably null
R7815:Insrr UTSW 3 87808695 missense probably damaging 0.98
R8159:Insrr UTSW 3 87800428 missense probably damaging 1.00
R8289:Insrr UTSW 3 87814194 missense probably damaging 1.00
R8309:Insrr UTSW 3 87810442 missense probably benign 0.00
R8312:Insrr UTSW 3 87800484 missense possibly damaging 0.93
R8445:Insrr UTSW 3 87813584 missense probably damaging 1.00
R8917:Insrr UTSW 3 87810969 missense probably benign 0.00
R8960:Insrr UTSW 3 87813079 missense probably damaging 1.00
R9015:Insrr UTSW 3 87813603 missense probably damaging 1.00
R9202:Insrr UTSW 3 87813120 missense probably damaging 1.00
R9251:Insrr UTSW 3 87810084 missense probably benign 0.08
R9327:Insrr UTSW 3 87814297 missense probably damaging 1.00
R9646:Insrr UTSW 3 87814498 missense probably damaging 1.00
RF022:Insrr UTSW 3 87804485 missense possibly damaging 0.51
Z1177:Insrr UTSW 3 87800827 missense possibly damaging 0.91
Z1192:Insrr UTSW 3 87802579 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTGATGAGACTCTGCTG -3'
(R):5'- TGTGAGTTCAGATGCCTCCC -3'

Sequencing Primer
(F):5'- TGATGAGACTCTGCTGGCAGC -3'
(R):5'- GAGTTCAGATGCCTCCCTTTCTGG -3'
Posted On 2021-10-11