Incidental Mutation 'R8989:Vmn2r72'
ID 684291
Institutional Source Beutler Lab
Gene Symbol Vmn2r72
Ensembl Gene ENSMUSG00000051877
Gene Name vomeronasal 2, receptor 72
Synonyms Vmn2r72-ps, EG244114
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock # R8989 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 85737784-85754981 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 85754926 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 19 (H19L)
Ref Sequence ENSEMBL: ENSMUSP00000133014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063425]
AlphaFold D3Z4N8
Predicted Effect probably benign
Transcript: ENSMUST00000063425
AA Change: H19L

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000133014
Gene: ENSMUSG00000051877
AA Change: H19L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 82 469 2.3e-28 PFAM
Pfam:NCD3G 512 564 1.2e-18 PFAM
Pfam:7tm_3 594 832 4e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik T C 19: 58,787,721 E100G probably damaging Het
2210408I21Rik A G 13: 77,612,605 I1260M probably benign Het
4931406P16Rik T C 7: 34,257,444 Q332R probably damaging Het
A1cf T A 19: 31,927,156 F273Y possibly damaging Het
A3galt2 T C 4: 128,761,438 W45R probably damaging Het
Adam23 A G 1: 63,549,789 E460G probably damaging Het
Ago1 T A 4: 126,463,790 T31S probably benign Het
Ago3 T A 4: 126,404,398 T110S probably damaging Het
Akap6 T C 12: 52,880,871 F188S probably damaging Het
Armc4 T C 18: 7,268,464 K352E probably benign Het
Asic2 G A 11: 81,152,354 P38S probably benign Het
Astn2 A T 4: 65,581,653 C1000S possibly damaging Het
Atp10b T A 11: 43,245,442 C1132* probably null Het
Atp7b A T 8: 22,020,895 S527T probably benign Het
Bod1l G A 5: 41,821,682 T763I probably benign Het
Capn11 A G 17: 45,643,857 L118P probably damaging Het
Col13a1 T C 10: 61,860,471 E589G unknown Het
Col6a2 T C 10: 76,604,181 D630G probably damaging Het
Ctnnd2 G A 15: 30,669,514 R423H probably damaging Het
Dld G A 12: 31,333,459 T447I probably damaging Het
Eif4g3 T C 4: 138,184,748 L1227S probably damaging Het
Elac1 C A 18: 73,747,239 E29* probably null Het
Ephb6 C T 6: 41,613,359 A15V probably benign Het
Fam189a2 T A 19: 23,984,832 Q269L probably damaging Het
Fancc G T 13: 63,400,276 L70M possibly damaging Het
Fgd6 T A 10: 94,123,563 M1041K probably damaging Het
Fn1 A G 1: 71,624,287 V1014A possibly damaging Het
Galnt1 C T 18: 24,269,510 T308I possibly damaging Het
Gm13101 C A 4: 143,965,200 A318S probably benign Het
Gpr63 T A 4: 25,007,357 V27D possibly damaging Het
Hcfc2 T C 10: 82,700,988 V78A probably damaging Het
Hexdc T A 11: 121,218,310 probably benign Het
Hipk1 T C 3: 103,761,644 T479A possibly damaging Het
Hkdc1 T C 10: 62,393,765 D711G probably damaging Het
Ifna16 A T 4: 88,676,675 F61Y probably damaging Het
Insrr T A 3: 87,815,357 N1295K probably damaging Het
Kif5b T A 18: 6,209,021 R914W probably damaging Het
Lpo T C 11: 87,817,834 T113A probably benign Het
Mmp21 T C 7: 133,675,017 D419G probably damaging Het
Naf1 A G 8: 66,860,976 T204A possibly damaging Het
Nsmce4a T C 7: 130,539,857 T201A probably benign Het
Nup160 T A 2: 90,717,864 N980K probably damaging Het
Olfr113 A T 17: 37,574,651 F257L probably benign Het
Olfr159 T C 4: 43,770,346 I222V possibly damaging Het
Olfr709-ps1 T A 7: 106,927,159 Q100L probably damaging Het
Pcdhb19 A G 18: 37,498,423 T424A probably benign Het
Pclo C T 5: 14,669,311 A1154V unknown Het
Psma8 T A 18: 14,757,347 D181E probably benign Het
Rhpn2 C A 7: 35,354,021 probably benign Het
Serpinb6e G T 13: 33,838,984 H139N possibly damaging Het
Slc26a7 T A 4: 14,533,642 I394F probably damaging Het
Stxbp5l ATTTT ATTTTT 16: 37,216,052 probably null Het
Taok3 T C 5: 117,241,162 S421P probably benign Het
Tas2r143 T G 6: 42,400,894 D219E probably damaging Het
Tcaf1 G A 6: 42,686,773 R58C probably damaging Het
Tenm3 A T 8: 48,235,348 Y2401* probably null Het
Tut1 T C 19: 8,959,752 V200A possibly damaging Het
Unc5c T A 3: 141,803,706 probably benign Het
Vmn2r28 T G 7: 5,490,474 I158L probably benign Het
Xpo4 A G 14: 57,591,018 M795T probably benign Het
Zc3h12a C A 4: 125,120,950 R247L probably damaging Het
Zfp521 C A 18: 13,846,080 L425F probably damaging Het
Other mutations in Vmn2r72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Vmn2r72 APN 7 85749646 missense probably benign 0.01
IGL01019:Vmn2r72 APN 7 85738334 missense probably benign 0.26
IGL01445:Vmn2r72 APN 7 85749646 missense probably benign 0.06
IGL02076:Vmn2r72 APN 7 85738367 missense probably damaging 1.00
IGL02082:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02086:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02089:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02125:Vmn2r72 APN 7 85750711 missense probably benign 0.00
IGL02146:Vmn2r72 APN 7 85737962 missense probably damaging 1.00
IGL02272:Vmn2r72 APN 7 85750693 missense probably benign
IGL02514:Vmn2r72 APN 7 85738699 missense possibly damaging 0.90
IGL02662:Vmn2r72 APN 7 85738183 missense probably benign 0.26
IGL02697:Vmn2r72 APN 7 85738671 missense probably benign 0.36
IGL02733:Vmn2r72 APN 7 85751813 missense probably benign 0.05
IGL03070:Vmn2r72 APN 7 85752041 splice site probably benign
IGL03150:Vmn2r72 APN 7 85751176 missense probably damaging 1.00
IGL03159:Vmn2r72 APN 7 85754954 missense probably benign 0.05
IGL03333:Vmn2r72 APN 7 85750867 missense probably benign 0.10
R0081:Vmn2r72 UTSW 7 85751836 missense probably benign 0.01
R0090:Vmn2r72 UTSW 7 85754876 missense probably benign
R0655:Vmn2r72 UTSW 7 85738111 nonsense probably null
R0778:Vmn2r72 UTSW 7 85749739 missense probably benign 0.00
R1169:Vmn2r72 UTSW 7 85751309 missense probably benign 0.01
R1172:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1173:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1175:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1248:Vmn2r72 UTSW 7 85749188 missense probably benign 0.02
R1302:Vmn2r72 UTSW 7 85738257 missense probably damaging 1.00
R1506:Vmn2r72 UTSW 7 85749211 missense probably benign
R1632:Vmn2r72 UTSW 7 85751792 missense probably benign 0.13
R1775:Vmn2r72 UTSW 7 85738170 missense probably benign 0.01
R1962:Vmn2r72 UTSW 7 85749161 missense probably benign 0.00
R2201:Vmn2r72 UTSW 7 85738236 missense probably benign 0.12
R2290:Vmn2r72 UTSW 7 85738341 missense probably damaging 1.00
R2327:Vmn2r72 UTSW 7 85738256 missense probably damaging 1.00
R2424:Vmn2r72 UTSW 7 85750953 missense probably damaging 1.00
R2655:Vmn2r72 UTSW 7 85751269 missense possibly damaging 0.95
R2860:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2861:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2862:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R3009:Vmn2r72 UTSW 7 85749642 missense probably benign 0.00
R3797:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3798:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3902:Vmn2r72 UTSW 7 85749735 missense possibly damaging 0.52
R3959:Vmn2r72 UTSW 7 85751131 missense probably benign 0.36
R3974:Vmn2r72 UTSW 7 85749809 missense probably damaging 1.00
R4399:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4421:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4426:Vmn2r72 UTSW 7 85737828 nonsense probably null
R4522:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4523:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4533:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4691:Vmn2r72 UTSW 7 85737911 nonsense probably null
R4781:Vmn2r72 UTSW 7 85737861 missense probably benign 0.14
R4863:Vmn2r72 UTSW 7 85750598 missense possibly damaging 0.91
R4952:Vmn2r72 UTSW 7 85751109 missense probably benign
R4991:Vmn2r72 UTSW 7 85751130 missense probably damaging 0.99
R4995:Vmn2r72 UTSW 7 85738485 missense probably damaging 1.00
R5095:Vmn2r72 UTSW 7 85737853 missense probably damaging 0.98
R5174:Vmn2r72 UTSW 7 85737840 missense probably benign 0.00
R5276:Vmn2r72 UTSW 7 85738254 missense possibly damaging 0.90
R5395:Vmn2r72 UTSW 7 85750897 missense possibly damaging 0.71
R5560:Vmn2r72 UTSW 7 85751942 missense probably damaging 0.96
R5933:Vmn2r72 UTSW 7 85737850 missense probably benign 0.05
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6354:Vmn2r72 UTSW 7 85750539 critical splice donor site probably null
R6362:Vmn2r72 UTSW 7 85751174 missense probably damaging 1.00
R6594:Vmn2r72 UTSW 7 85749684 missense probably benign 0.32
R6794:Vmn2r72 UTSW 7 85737996 missense probably damaging 1.00
R7113:Vmn2r72 UTSW 7 85749803 splice site probably null
R7189:Vmn2r72 UTSW 7 85754917 missense probably benign 0.36
R7266:Vmn2r72 UTSW 7 85738274 nonsense probably null
R7323:Vmn2r72 UTSW 7 85750563 missense probably benign
R7426:Vmn2r72 UTSW 7 85751140 missense probably benign
R7606:Vmn2r72 UTSW 7 85751154 missense possibly damaging 0.91
R7651:Vmn2r72 UTSW 7 85751938 missense probably damaging 1.00
R7688:Vmn2r72 UTSW 7 85754890 missense probably benign 0.32
R7753:Vmn2r72 UTSW 7 85750626 missense probably damaging 1.00
R7843:Vmn2r72 UTSW 7 85749630 missense probably benign 0.01
R8157:Vmn2r72 UTSW 7 85751233 missense probably benign 0.09
R8254:Vmn2r72 UTSW 7 85751019 missense probably damaging 1.00
R8389:Vmn2r72 UTSW 7 85751960 missense probably damaging 0.99
R8444:Vmn2r72 UTSW 7 85738175 missense probably benign
R9015:Vmn2r72 UTSW 7 85749180 missense probably benign 0.01
R9080:Vmn2r72 UTSW 7 85738256 missense probably damaging 1.00
R9269:Vmn2r72 UTSW 7 85751203 missense probably benign 0.03
R9317:Vmn2r72 UTSW 7 85754814 missense probably benign 0.04
Z1176:Vmn2r72 UTSW 7 85749191 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCCAGAAGACACATGGTATC -3'
(R):5'- GGTACAGTAATAAATAGTGTCACCTGG -3'

Sequencing Primer
(F):5'- ATATCTCAGTATCTCTGTCTTGTCTC -3'
(R):5'- AAATAGTGTCACCTGGATGGGTTCAC -3'
Posted On 2021-10-11