Incidental Mutation 'R8990:Pced1a'
ID 684336
Institutional Source Beutler Lab
Gene Symbol Pced1a
Ensembl Gene ENSMUSG00000037773
Gene Name PC-esterase domain containing 1A
Synonyms Fam113a, A930025D01Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8990 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 130417247-130424701 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 130422551 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 120 (Y120H)
Ref Sequence ENSEMBL: ENSMUSP00000087009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000089581] [ENSMUST00000110277] [ENSMUST00000128994]
AlphaFold Q6P1Z5
Predicted Effect probably benign
Transcript: ENSMUST00000028900
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000089581
AA Change: Y120H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087009
Gene: ENSMUSG00000037773
AA Change: Y120H

DomainStartEndE-ValueType
Pfam:PC-Esterase 18 267 4e-52 PFAM
low complexity region 308 346 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110277
AA Change: Y120H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105906
Gene: ENSMUSG00000037773
AA Change: Y120H

DomainStartEndE-ValueType
Pfam:PC-Esterase 21 268 3.8e-51 PFAM
low complexity region 308 346 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128994
SMART Domains Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 212 3.2e-74 PFAM
Pfam:Vps16_N 205 316 1e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the GDSL/SGNH superfamily. Members of this family are hydrolytic enzymes with esterase and lipase activity and broad substrate specificity. This protein belongs to the Pmr5-Cas1p-esterase subfamily in that it contains the catalytic triad comprised of serine, aspartate and histidine and lacks two conserved regions (glycine after strand S2 and GxND motif). A pseudogene of this gene has been identified on the long arm of chromosome 2. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik A G 10: 43,525,237 S239P unknown Het
2010111I01Rik G A 13: 63,156,614 C480Y probably damaging Het
4930572O03Rik G A 5: 15,653,600 R141C probably benign Het
4932438A13Rik T C 3: 36,921,221 S681P possibly damaging Het
Abcb11 C T 2: 69,274,150 V731M Het
Ank2 A G 3: 127,048,180 probably null Het
Ano8 G C 8: 71,476,557 P1004R unknown Het
Asnsd1 C T 1: 53,346,742 G491D probably damaging Het
Atp6v1c2 A G 12: 17,291,646 V248A probably benign Het
BC035947 C T 1: 78,498,849 V349M probably damaging Het
Bcl2l14 A G 6: 134,423,667 D17G probably damaging Het
Cbs T C 17: 31,615,549 T489A probably benign Het
Ccdc66 T C 14: 27,486,698 K533R probably benign Het
Cenpx A G 11: 120,711,765 F53S unknown Het
Col4a4 A G 1: 82,495,834 S657P unknown Het
Csnk2a1 A G 2: 152,254,257 Y50C probably damaging Het
Ddx60 C T 8: 61,974,134 R748* probably null Het
Diaph1 A T 18: 37,855,804 L959H probably damaging Het
Dnaaf5 T G 5: 139,170,196 L544R probably damaging Het
Dnah10 A G 5: 124,736,993 D399G Het
Eif2b4 T C 5: 31,190,627 E247G probably benign Het
Elmsan1 T C 12: 84,171,606 T527A probably benign Het
Fmnl2 T C 2: 53,126,959 I1050T unknown Het
Gm10272 T A 10: 77,706,824 S67T probably damaging Het
Gm15448 T A 7: 3,821,274 T627S unknown Het
Gm32742 G A 9: 51,147,502 P1072S probably damaging Het
Hdac11 T A 6: 91,168,817 L151* probably null Het
Iars A G 13: 49,688,276 D80G possibly damaging Het
Kazn T C 4: 142,141,636 D413G probably damaging Het
Kcnc1 T A 7: 46,428,309 *512R probably null Het
Kcnf1 G A 12: 17,175,335 T295I probably benign Het
Klhl9 A G 4: 88,721,968 V12A probably benign Het
Klk6 T A 7: 43,826,830 H31Q probably benign Het
Ldhal6b A T 17: 5,417,745 S305T probably damaging Het
Lta4h C A 10: 93,478,453 D462E probably damaging Het
Ly75 T G 2: 60,358,559 R274S probably benign Het
Mn1 A G 5: 111,418,515 N117S possibly damaging Het
Mrgprd T C 7: 145,322,178 V262A probably benign Het
Muc4 C A 16: 32,752,209 H696N probably benign Het
Nlrp3 A T 11: 59,548,758 Q387L probably damaging Het
Nme7 A G 1: 164,328,333 D34G probably damaging Het
Ntrk2 T A 13: 58,860,174 L250* probably null Het
Olfr1340 T C 4: 118,727,027 V260A probably benign Het
Palld C T 8: 61,515,245 E1096K probably damaging Het
Pcdh7 A G 5: 57,722,022 D973G probably benign Het
Pkhd1 A G 1: 20,347,305 S2541P probably benign Het
Ptcd1 A G 5: 145,165,237 S91P probably damaging Het
R3hdm1 C T 1: 128,179,096 R229C probably damaging Het
Sectm1a G T 11: 121,069,875 T38K probably damaging Het
Serpinb2 A T 1: 107,522,698 I142F probably damaging Het
Slc25a39 A T 11: 102,405,069 V112E possibly damaging Het
Sp8 T A 12: 118,849,387 Y326N possibly damaging Het
Trpc2 T C 7: 102,095,988 Y804H probably benign Het
Trpc7 T C 13: 56,804,672 N562S possibly damaging Het
Trpm6 G A 19: 18,815,435 G741E probably damaging Het
Vmn1r160 T A 7: 22,871,334 H37Q probably damaging Het
Vmn1r174 G T 7: 23,754,531 M207I possibly damaging Het
Zfp521 C A 18: 13,846,080 L425F probably damaging Het
Other mutations in Pced1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Pced1a APN 2 130419178 missense probably benign 0.00
IGL02173:Pced1a APN 2 130422328 missense possibly damaging 0.46
IGL02547:Pced1a APN 2 130419707 missense possibly damaging 0.74
IGL02729:Pced1a APN 2 130421903 missense probably benign 0.01
IGL03107:Pced1a APN 2 130422835 missense possibly damaging 0.81
R0139:Pced1a UTSW 2 130421907 missense probably benign 0.00
R0550:Pced1a UTSW 2 130419633 missense probably benign 0.00
R0578:Pced1a UTSW 2 130419843 missense probably damaging 0.98
R3037:Pced1a UTSW 2 130419859 missense probably benign 0.40
R3157:Pced1a UTSW 2 130419767 missense probably benign 0.12
R4578:Pced1a UTSW 2 130422676 missense probably damaging 1.00
R5306:Pced1a UTSW 2 130419171 missense probably benign
R6210:Pced1a UTSW 2 130421919 missense probably damaging 1.00
R7444:Pced1a UTSW 2 130422059 missense probably damaging 0.98
R7459:Pced1a UTSW 2 130419824 missense possibly damaging 0.59
R7524:Pced1a UTSW 2 130422028 missense probably benign 0.44
R7744:Pced1a UTSW 2 130422052 missense probably damaging 1.00
R7782:Pced1a UTSW 2 130422515 missense probably damaging 0.99
R7851:Pced1a UTSW 2 130422316 missense probably damaging 0.99
R8300:Pced1a UTSW 2 130424237 unclassified probably benign
R8404:Pced1a UTSW 2 130423657 unclassified probably benign
R8502:Pced1a UTSW 2 130423657 unclassified probably benign
Z1177:Pced1a UTSW 2 130422628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGTAGCTCTCCATTGAG -3'
(R):5'- ACCTACCTGGCATGGATCTG -3'

Sequencing Primer
(F):5'- CGGCCATATCTGTTGGGTAACAC -3'
(R):5'- ACCTGGCATGGATCTGACCATC -3'
Posted On 2021-10-11