Incidental Mutation 'R8990:Kazn'
ID 684342
Institutional Source Beutler Lab
Gene Symbol Kazn
Ensembl Gene ENSMUSG00000040606
Gene Name kazrin, periplakin interacting protein
Synonyms 9030409G11Rik, 2310007B04Rik
MMRRC Submission 068822-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.174) question?
Stock # R8990 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 141829701-142205056 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 141868947 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 413 (D413G)
Ref Sequence ENSEMBL: ENSMUSP00000038835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036476] [ENSMUST00000129032]
AlphaFold Q69ZS8
Predicted Effect probably damaging
Transcript: ENSMUST00000036476
AA Change: D413G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000038835
Gene: ENSMUSG00000040606
AA Change: D413G

DomainStartEndE-ValueType
low complexity region 68 88 N/A INTRINSIC
SCOP:d1eq1a_ 113 248 8e-3 SMART
low complexity region 368 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129032
SMART Domains Protein: ENSMUSP00000115897
Gene: ENSMUSG00000040606

DomainStartEndE-ValueType
coiled coil region 7 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155023
SMART Domains Protein: ENSMUSP00000116071
Gene: ENSMUSG00000040606

DomainStartEndE-ValueType
coiled coil region 1 180 N/A INTRINSIC
low complexity region 299 306 N/A INTRINSIC
SAM 367 435 6.32e-6 SMART
SAM 444 512 4.17e-6 SMART
SAM 533 602 3.37e-1 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000133972
Gene: ENSMUSG00000040606
AA Change: D343G

DomainStartEndE-ValueType
coiled coil region 1 180 N/A INTRINSIC
low complexity region 299 306 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173068
SMART Domains Protein: ENSMUSP00000134498
Gene: ENSMUSG00000040606

DomainStartEndE-ValueType
coiled coil region 1 74 N/A INTRINSIC
low complexity region 194 201 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000134631
Gene: ENSMUSG00000040606
AA Change: D344G

DomainStartEndE-ValueType
coiled coil region 1 180 N/A INTRINSIC
low complexity region 300 307 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays a role in desmosome assembly, cell adhesion, cytoskeletal organization, and epidermal differentiation. This protein co-localizes with desmoplakin and the cytolinker protein periplakin. In general, this protein localizes to the nucleus, desmosomes, cell membrane, and cortical actin-based structures. Some isoforms of this protein also associate with microtubules. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their biological validity has not been verified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable, fertile and grossly normal with no obvious defects in skin development or homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,104,494 (GRCm39) V731M Het
Ank2 A G 3: 126,841,829 (GRCm39) probably null Het
Ano8 G C 8: 71,929,201 (GRCm39) P1004R unknown Het
Aopep G A 13: 63,304,428 (GRCm39) C480Y probably damaging Het
Asnsd1 C T 1: 53,385,901 (GRCm39) G491D probably damaging Het
Atp6v1c2 A G 12: 17,341,647 (GRCm39) V248A probably benign Het
BC035947 C T 1: 78,475,486 (GRCm39) V349M probably damaging Het
Bcl2l14 A G 6: 134,400,630 (GRCm39) D17G probably damaging Het
Bltp1 T C 3: 36,975,370 (GRCm39) S681P possibly damaging Het
Cbs T C 17: 31,834,523 (GRCm39) T489A probably benign Het
Ccdc66 T C 14: 27,208,655 (GRCm39) K533R probably benign Het
Cenpx A G 11: 120,602,591 (GRCm39) F53S unknown Het
Col4a4 A G 1: 82,473,555 (GRCm39) S657P unknown Het
Csnk2a1 A G 2: 152,096,177 (GRCm39) Y50C probably damaging Het
Ddx60 C T 8: 62,427,168 (GRCm39) R748* probably null Het
Diaph1 A T 18: 37,988,857 (GRCm39) L959H probably damaging Het
Dnaaf5 T G 5: 139,155,951 (GRCm39) L544R probably damaging Het
Dnah10 A G 5: 124,814,057 (GRCm39) D399G Het
Eif2b4 T C 5: 31,347,971 (GRCm39) E247G probably benign Het
Fmnl2 T C 2: 53,016,971 (GRCm39) I1050T unknown Het
Gm10272 T A 10: 77,542,658 (GRCm39) S67T probably damaging Het
Gm32742 G A 9: 51,058,802 (GRCm39) P1072S probably damaging Het
Hdac11 T A 6: 91,145,799 (GRCm39) L151* probably null Het
Iars1 A G 13: 49,841,752 (GRCm39) D80G possibly damaging Het
Kcnc1 T A 7: 46,077,733 (GRCm39) *512R probably null Het
Kcnf1 G A 12: 17,225,336 (GRCm39) T295I probably benign Het
Klhl9 A G 4: 88,640,205 (GRCm39) V12A probably benign Het
Klk6 T A 7: 43,476,254 (GRCm39) H31Q probably benign Het
Ldhal6b A T 17: 5,468,020 (GRCm39) S305T probably damaging Het
Lta4h C A 10: 93,314,315 (GRCm39) D462E probably damaging Het
Ly75 T G 2: 60,188,903 (GRCm39) R274S probably benign Het
Mideas T C 12: 84,218,380 (GRCm39) T527A probably benign Het
Mn1 A G 5: 111,566,381 (GRCm39) N117S possibly damaging Het
Mrgprd T C 7: 144,875,915 (GRCm39) V262A probably benign Het
Mtres1 A G 10: 43,401,233 (GRCm39) S239P unknown Het
Muc4 C A 16: 32,574,009 (GRCm39) H696N probably benign Het
Nlrp3 A T 11: 59,439,584 (GRCm39) Q387L probably damaging Het
Nme7 A G 1: 164,155,902 (GRCm39) D34G probably damaging Het
Ntrk2 T A 13: 59,007,988 (GRCm39) L250* probably null Het
Or13p8 T C 4: 118,584,224 (GRCm39) V260A probably benign Het
Palld C T 8: 61,968,279 (GRCm39) E1096K probably damaging Het
Pcdh7 A G 5: 57,879,364 (GRCm39) D973G probably benign Het
Pced1a A G 2: 130,264,471 (GRCm39) Y120H probably damaging Het
Pira13 T A 7: 3,824,273 (GRCm39) T627S unknown Het
Pkhd1 A G 1: 20,417,529 (GRCm39) S2541P probably benign Het
Ptcd1 A G 5: 145,102,047 (GRCm39) S91P probably damaging Het
R3hdm1 C T 1: 128,106,833 (GRCm39) R229C probably damaging Het
Sectm1a G T 11: 120,960,701 (GRCm39) T38K probably damaging Het
Serpinb2 A T 1: 107,450,428 (GRCm39) I142F probably damaging Het
Slc25a39 A T 11: 102,295,895 (GRCm39) V112E possibly damaging Het
Snap23 G T 2: 120,415,516 (GRCm39) probably benign Het
Sp8 T A 12: 118,813,122 (GRCm39) Y326N possibly damaging Het
Speer4c2 G A 5: 15,858,598 (GRCm39) R141C probably benign Het
Spock1 A T 13: 57,843,984 (GRCm39) probably null Het
Trpc2 T C 7: 101,745,195 (GRCm39) Y804H probably benign Het
Trpc7 T C 13: 56,952,485 (GRCm39) N562S possibly damaging Het
Trpm6 G A 19: 18,792,799 (GRCm39) G741E probably damaging Het
Vmn1r160 T A 7: 22,570,759 (GRCm39) H37Q probably damaging Het
Vmn1r174 G T 7: 23,453,956 (GRCm39) M207I possibly damaging Het
Zfp521 C A 18: 13,979,137 (GRCm39) L425F probably damaging Het
Other mutations in Kazn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Kazn APN 4 141,886,354 (GRCm39) critical splice donor site probably null
IGL01959:Kazn APN 4 141,878,195 (GRCm39) missense probably damaging 1.00
IGL02237:Kazn APN 4 141,874,410 (GRCm39) missense probably benign 0.31
IGL02351:Kazn APN 4 141,874,327 (GRCm39) critical splice donor site probably null
IGL02358:Kazn APN 4 141,874,327 (GRCm39) critical splice donor site probably null
R1173:Kazn UTSW 4 141,886,349 (GRCm39) splice site probably benign
R2206:Kazn UTSW 4 141,845,603 (GRCm39) splice site probably null
R3406:Kazn UTSW 4 141,966,506 (GRCm39) start gained probably benign
R4007:Kazn UTSW 4 141,834,203 (GRCm39) missense unknown
R4050:Kazn UTSW 4 141,834,215 (GRCm39) missense unknown
R4598:Kazn UTSW 4 141,937,403 (GRCm39) missense possibly damaging 0.53
R4606:Kazn UTSW 4 141,845,599 (GRCm39) splice site probably null
R4631:Kazn UTSW 4 141,845,471 (GRCm39) unclassified probably benign
R4866:Kazn UTSW 4 141,832,216 (GRCm39) missense unknown
R5050:Kazn UTSW 4 141,845,514 (GRCm39) unclassified probably benign
R5052:Kazn UTSW 4 141,845,514 (GRCm39) unclassified probably benign
R5054:Kazn UTSW 4 141,835,957 (GRCm39) missense unknown
R5758:Kazn UTSW 4 141,868,982 (GRCm39) critical splice donor site probably null
R6152:Kazn UTSW 4 141,836,598 (GRCm39) missense unknown
R6284:Kazn UTSW 4 141,844,508 (GRCm39) missense probably benign 0.04
R7289:Kazn UTSW 4 141,844,486 (GRCm39) missense
R7414:Kazn UTSW 4 141,836,649 (GRCm39) missense
R7663:Kazn UTSW 4 141,832,209 (GRCm39) missense
R7814:Kazn UTSW 4 141,937,481 (GRCm39) missense unknown
R8031:Kazn UTSW 4 141,881,862 (GRCm39) missense
R8184:Kazn UTSW 4 141,845,441 (GRCm39) missense probably benign 0.04
R8315:Kazn UTSW 4 141,869,002 (GRCm39) missense
R8779:Kazn UTSW 4 141,881,856 (GRCm39) missense
R9491:Kazn UTSW 4 141,845,436 (GRCm39) missense
Z1177:Kazn UTSW 4 141,881,815 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- ATTACAGAGGTGACGACGCG -3'
(R):5'- ACCAGGCTAACTTCACCTTTG -3'

Sequencing Primer
(F):5'- GGTCACATTTGTGTTTCTGCC -3'
(R):5'- AGGCTAACTTCACCTTTGTTCTTC -3'
Posted On 2021-10-11