Incidental Mutation 'R8990:Ddx60'
ID 684360
Institutional Source Beutler Lab
Gene Symbol Ddx60
Ensembl Gene ENSMUSG00000037921
Gene Name DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock # R8990 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 61928087-62038244 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 61974134 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 748 (R748*)
Ref Sequence ENSEMBL: ENSMUSP00000091197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485]
AlphaFold E9PZQ1
Predicted Effect probably null
Transcript: ENSMUST00000070631
AA Change: R747*
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: R747*

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000093485
AA Change: R748*
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: R748*

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik A G 10: 43,525,237 S239P unknown Het
2010111I01Rik G A 13: 63,156,614 C480Y probably damaging Het
4930572O03Rik G A 5: 15,653,600 R141C probably benign Het
4932438A13Rik T C 3: 36,921,221 S681P possibly damaging Het
Abcb11 C T 2: 69,274,150 V731M Het
Ank2 A G 3: 127,048,180 probably null Het
Ano8 G C 8: 71,476,557 P1004R unknown Het
Asnsd1 C T 1: 53,346,742 G491D probably damaging Het
Atp6v1c2 A G 12: 17,291,646 V248A probably benign Het
BC035947 C T 1: 78,498,849 V349M probably damaging Het
Bcl2l14 A G 6: 134,423,667 D17G probably damaging Het
Cbs T C 17: 31,615,549 T489A probably benign Het
Ccdc66 T C 14: 27,486,698 K533R probably benign Het
Cenpx A G 11: 120,711,765 F53S unknown Het
Col4a4 A G 1: 82,495,834 S657P unknown Het
Csnk2a1 A G 2: 152,254,257 Y50C probably damaging Het
Diaph1 A T 18: 37,855,804 L959H probably damaging Het
Dnaaf5 T G 5: 139,170,196 L544R probably damaging Het
Dnah10 A G 5: 124,736,993 D399G Het
Eif2b4 T C 5: 31,190,627 E247G probably benign Het
Elmsan1 T C 12: 84,171,606 T527A probably benign Het
Fmnl2 T C 2: 53,126,959 I1050T unknown Het
Gm10272 T A 10: 77,706,824 S67T probably damaging Het
Gm15448 T A 7: 3,821,274 T627S unknown Het
Gm32742 G A 9: 51,147,502 P1072S probably damaging Het
Hdac11 T A 6: 91,168,817 L151* probably null Het
Iars A G 13: 49,688,276 D80G possibly damaging Het
Kazn T C 4: 142,141,636 D413G probably damaging Het
Kcnc1 T A 7: 46,428,309 *512R probably null Het
Kcnf1 G A 12: 17,175,335 T295I probably benign Het
Klhl9 A G 4: 88,721,968 V12A probably benign Het
Klk6 T A 7: 43,826,830 H31Q probably benign Het
Ldhal6b A T 17: 5,417,745 S305T probably damaging Het
Lta4h C A 10: 93,478,453 D462E probably damaging Het
Ly75 T G 2: 60,358,559 R274S probably benign Het
Mn1 A G 5: 111,418,515 N117S possibly damaging Het
Mrgprd T C 7: 145,322,178 V262A probably benign Het
Muc4 C A 16: 32,752,209 H696N probably benign Het
Nlrp3 A T 11: 59,548,758 Q387L probably damaging Het
Nme7 A G 1: 164,328,333 D34G probably damaging Het
Ntrk2 T A 13: 58,860,174 L250* probably null Het
Olfr1340 T C 4: 118,727,027 V260A probably benign Het
Palld C T 8: 61,515,245 E1096K probably damaging Het
Pcdh7 A G 5: 57,722,022 D973G probably benign Het
Pced1a A G 2: 130,422,551 Y120H probably damaging Het
Pkhd1 A G 1: 20,347,305 S2541P probably benign Het
Ptcd1 A G 5: 145,165,237 S91P probably damaging Het
R3hdm1 C T 1: 128,179,096 R229C probably damaging Het
Sectm1a G T 11: 121,069,875 T38K probably damaging Het
Serpinb2 A T 1: 107,522,698 I142F probably damaging Het
Slc25a39 A T 11: 102,405,069 V112E possibly damaging Het
Sp8 T A 12: 118,849,387 Y326N possibly damaging Het
Trpc2 T C 7: 102,095,988 Y804H probably benign Het
Trpc7 T C 13: 56,804,672 N562S possibly damaging Het
Trpm6 G A 19: 18,815,435 G741E probably damaging Het
Vmn1r160 T A 7: 22,871,334 H37Q probably damaging Het
Vmn1r174 G T 7: 23,754,531 M207I possibly damaging Het
Zfp521 C A 18: 13,846,080 L425F probably damaging Het
Other mutations in Ddx60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ddx60 APN 8 61958646 missense probably damaging 1.00
IGL00915:Ddx60 APN 8 61987431 missense possibly damaging 0.79
IGL00931:Ddx60 APN 8 61969583 missense probably benign 0.18
IGL01023:Ddx60 APN 8 61942514 missense probably damaging 0.99
IGL01313:Ddx60 APN 8 61982526 missense probably damaging 1.00
IGL01615:Ddx60 APN 8 61963740 missense probably null 0.81
IGL01733:Ddx60 APN 8 61983865 missense probably damaging 0.99
IGL01779:Ddx60 APN 8 62017823 missense possibly damaging 0.94
IGL01900:Ddx60 APN 8 62000709 splice site probably benign
IGL02110:Ddx60 APN 8 62017247 critical splice donor site probably null
IGL02302:Ddx60 APN 8 61975832 missense possibly damaging 0.85
IGL02468:Ddx60 APN 8 61958642 missense probably damaging 1.00
IGL02569:Ddx60 APN 8 62024951 missense possibly damaging 0.93
IGL02622:Ddx60 APN 8 61942436 splice site probably null
IGL02657:Ddx60 APN 8 61984115 missense probably benign 0.01
IGL02677:Ddx60 APN 8 61988132 missense probably damaging 1.00
IGL02701:Ddx60 APN 8 61979341 missense probably damaging 0.96
IGL02806:Ddx60 APN 8 61956122 missense probably benign 0.00
IGL03137:Ddx60 APN 8 61988083 missense possibly damaging 0.61
IGL03295:Ddx60 APN 8 61956121 missense possibly damaging 0.82
IGL03387:Ddx60 APN 8 62012449 missense probably damaging 1.00
IGL03411:Ddx60 APN 8 61977882 critical splice acceptor site probably null
Scatter UTSW 8 62021314 missense possibly damaging 0.80
shotgun UTSW 8 62037067 missense probably benign 0.28
splay UTSW 8 62021309 missense possibly damaging 0.80
G1Funyon:Ddx60 UTSW 8 62000597 missense probably benign 0.01
PIT4504001:Ddx60 UTSW 8 61958113 missense probably benign
PIT4677001:Ddx60 UTSW 8 61972254 missense possibly damaging 0.87
R0090:Ddx60 UTSW 8 61942293 missense probably damaging 1.00
R0266:Ddx60 UTSW 8 62033493 missense possibly damaging 0.92
R0325:Ddx60 UTSW 8 61983855 missense probably benign 0.00
R0367:Ddx60 UTSW 8 62017749 missense possibly damaging 0.78
R0403:Ddx60 UTSW 8 61994541 splice site probably benign
R0479:Ddx60 UTSW 8 61969657 missense probably damaging 1.00
R0561:Ddx60 UTSW 8 62017794 missense possibly damaging 0.93
R0844:Ddx60 UTSW 8 61987361 missense probably benign 0.27
R1119:Ddx60 UTSW 8 61942544 missense probably damaging 1.00
R1428:Ddx60 UTSW 8 61958159 splice site probably benign
R1778:Ddx60 UTSW 8 61974176 missense possibly damaging 0.85
R1840:Ddx60 UTSW 8 61969553 missense probably damaging 0.99
R1964:Ddx60 UTSW 8 61948869 missense probably benign 0.10
R1970:Ddx60 UTSW 8 61972206 missense possibly damaging 0.93
R2101:Ddx60 UTSW 8 61940645 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 61956141 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 62017200 missense probably benign 0.01
R2198:Ddx60 UTSW 8 61958063 missense possibly damaging 0.79
R2332:Ddx60 UTSW 8 62037091 missense probably benign 0.08
R2338:Ddx60 UTSW 8 62012436 missense possibly damaging 0.91
R2379:Ddx60 UTSW 8 62037088 missense probably damaging 1.00
R4010:Ddx60 UTSW 8 61954535 missense possibly damaging 0.65
R4010:Ddx60 UTSW 8 61956144 missense probably benign 0.25
R4133:Ddx60 UTSW 8 61972220 missense probably damaging 0.99
R4282:Ddx60 UTSW 8 61994393 missense probably damaging 0.99
R4382:Ddx60 UTSW 8 61948978 splice site probably null
R4561:Ddx60 UTSW 8 61942461 missense probably damaging 0.96
R4572:Ddx60 UTSW 8 61987421 missense probably damaging 1.00
R4581:Ddx60 UTSW 8 62023261 missense possibly damaging 0.90
R4635:Ddx60 UTSW 8 62037067 missense probably benign 0.28
R4698:Ddx60 UTSW 8 62012424 missense probably benign 0.01
R4807:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R4858:Ddx60 UTSW 8 62021314 missense possibly damaging 0.80
R4964:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R5120:Ddx60 UTSW 8 61945906 missense probably benign 0.01
R5187:Ddx60 UTSW 8 61974188 missense probably damaging 1.00
R5222:Ddx60 UTSW 8 61984158 missense probably damaging 0.99
R5400:Ddx60 UTSW 8 62010002 missense possibly damaging 0.65
R5500:Ddx60 UTSW 8 61950451 missense probably benign 0.28
R5514:Ddx60 UTSW 8 61958057 missense probably damaging 1.00
R5668:Ddx60 UTSW 8 62000578 missense probably benign 0.38
R5742:Ddx60 UTSW 8 61948921 missense probably benign
R5772:Ddx60 UTSW 8 61948897 missense probably damaging 1.00
R5810:Ddx60 UTSW 8 62012388 nonsense probably null
R5815:Ddx60 UTSW 8 61963722 missense probably damaging 0.98
R5820:Ddx60 UTSW 8 61956121 missense possibly damaging 0.82
R5866:Ddx60 UTSW 8 61940740 missense probably damaging 1.00
R5881:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R5977:Ddx60 UTSW 8 62021410 critical splice donor site probably null
R6048:Ddx60 UTSW 8 62000582 missense probably benign 0.01
R6061:Ddx60 UTSW 8 62023241 missense probably null 0.01
R6153:Ddx60 UTSW 8 61945940 missense possibly damaging 0.47
R6287:Ddx60 UTSW 8 61950578 missense probably damaging 1.00
R6415:Ddx60 UTSW 8 61983905 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61977950 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61998681 missense probably benign
R6660:Ddx60 UTSW 8 61956239 missense probably benign 0.00
R6694:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R6715:Ddx60 UTSW 8 61983890 missense probably benign 0.03
R6720:Ddx60 UTSW 8 62000689 missense probably benign 0.10
R6937:Ddx60 UTSW 8 62037069 missense probably damaging 1.00
R7153:Ddx60 UTSW 8 61988108 missense possibly damaging 0.71
R7274:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R7409:Ddx60 UTSW 8 61958578 missense probably benign 0.24
R7464:Ddx60 UTSW 8 61940674 missense possibly damaging 0.82
R7670:Ddx60 UTSW 8 61975792 missense probably damaging 1.00
R7904:Ddx60 UTSW 8 61977890 missense possibly damaging 0.81
R7992:Ddx60 UTSW 8 61954535 missense probably benign 0.03
R8124:Ddx60 UTSW 8 61983911 missense probably benign
R8125:Ddx60 UTSW 8 61983911 missense probably benign
R8126:Ddx60 UTSW 8 61983911 missense probably benign
R8155:Ddx60 UTSW 8 62017171 missense possibly damaging 0.61
R8174:Ddx60 UTSW 8 62017250 splice site probably null
R8192:Ddx60 UTSW 8 61977968 missense probably damaging 1.00
R8271:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R8301:Ddx60 UTSW 8 62000597 missense probably benign 0.01
R8304:Ddx60 UTSW 8 61998769 missense possibly damaging 0.67
R8319:Ddx60 UTSW 8 61942635 critical splice donor site probably null
R8374:Ddx60 UTSW 8 61974171 missense probably benign 0.01
R8401:Ddx60 UTSW 8 61956243 missense possibly damaging 0.57
R8487:Ddx60 UTSW 8 61974150 missense probably damaging 1.00
R8804:Ddx60 UTSW 8 61958606 missense probably benign 0.27
R8826:Ddx60 UTSW 8 61945956 missense probably benign 0.02
R8829:Ddx60 UTSW 8 61940661 missense probably damaging 1.00
R8881:Ddx60 UTSW 8 62021309 missense possibly damaging 0.80
R8884:Ddx60 UTSW 8 61994519 missense possibly damaging 0.86
R9122:Ddx60 UTSW 8 61989864 missense probably benign 0.16
R9225:Ddx60 UTSW 8 62017841 missense probably benign 0.36
R9278:Ddx60 UTSW 8 61977978 missense possibly damaging 0.83
R9293:Ddx60 UTSW 8 62009960 missense possibly damaging 0.89
R9405:Ddx60 UTSW 8 61972214 missense probably benign 0.03
X0003:Ddx60 UTSW 8 62033417 missense possibly damaging 0.88
X0019:Ddx60 UTSW 8 61963692 missense probably benign 0.01
Z1177:Ddx60 UTSW 8 62000588 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCAGAAAAGTGGTAAGGTCTTCATG -3'
(R):5'- TATGGATTCATTCAACACCTCACC -3'

Sequencing Primer
(F):5'- GGATGCATCAGATGGCATA -3'
(R):5'- TGCAGTTCATGGTAAGGACAAATATG -3'
Posted On 2021-10-11