Incidental Mutation 'R8990:Gm10272'
ID 684364
Institutional Source Beutler Lab
Gene Symbol Gm10272
Ensembl Gene ENSMUSG00000069584
Gene Name predicted gene 10272
Synonyms
MMRRC Submission 068822-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.102) question?
Stock # R8990 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 77542460-77542809 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 77542658 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 67 (S67T)
Ref Sequence ENSEMBL: ENSMUSP00000090025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075421] [ENSMUST00000092366] [ENSMUST00000092371]
AlphaFold F7CZ33
Predicted Effect probably benign
Transcript: ENSMUST00000075421
SMART Domains Protein: ENSMUSP00000074876
Gene: ENSMUSG00000094012

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 53 2.6e-8 PFAM
Pfam:Keratin_B2_2 29 74 9.2e-10 PFAM
low complexity region 92 105 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092366
SMART Domains Protein: ENSMUSP00000090020
Gene: ENSMUSG00000069581

DomainStartEndE-ValueType
Blast:TSPN 1 71 8e-40 BLAST
SCOP:d1c4ra_ 2 67 2e-7 SMART
low complexity region 190 200 N/A INTRINSIC
Pfam:EPTP 208 255 2.6e-22 PFAM
Pfam:EPTP 260 307 1.4e-21 PFAM
Pfam:EPTP 312 359 8.9e-14 PFAM
Pfam:EPTP 362 417 6.2e-13 PFAM
Pfam:EPTP 422 469 1.3e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092371
AA Change: S67T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090025
Gene: ENSMUSG00000069584
AA Change: S67T

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 53 1.8e-7 PFAM
Pfam:Keratin_B2_2 40 83 3.7e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,104,494 (GRCm39) V731M Het
Ank2 A G 3: 126,841,829 (GRCm39) probably null Het
Ano8 G C 8: 71,929,201 (GRCm39) P1004R unknown Het
Aopep G A 13: 63,304,428 (GRCm39) C480Y probably damaging Het
Asnsd1 C T 1: 53,385,901 (GRCm39) G491D probably damaging Het
Atp6v1c2 A G 12: 17,341,647 (GRCm39) V248A probably benign Het
BC035947 C T 1: 78,475,486 (GRCm39) V349M probably damaging Het
Bcl2l14 A G 6: 134,400,630 (GRCm39) D17G probably damaging Het
Bltp1 T C 3: 36,975,370 (GRCm39) S681P possibly damaging Het
Cbs T C 17: 31,834,523 (GRCm39) T489A probably benign Het
Ccdc66 T C 14: 27,208,655 (GRCm39) K533R probably benign Het
Cenpx A G 11: 120,602,591 (GRCm39) F53S unknown Het
Col4a4 A G 1: 82,473,555 (GRCm39) S657P unknown Het
Csnk2a1 A G 2: 152,096,177 (GRCm39) Y50C probably damaging Het
Ddx60 C T 8: 62,427,168 (GRCm39) R748* probably null Het
Diaph1 A T 18: 37,988,857 (GRCm39) L959H probably damaging Het
Dnaaf5 T G 5: 139,155,951 (GRCm39) L544R probably damaging Het
Dnah10 A G 5: 124,814,057 (GRCm39) D399G Het
Eif2b4 T C 5: 31,347,971 (GRCm39) E247G probably benign Het
Fmnl2 T C 2: 53,016,971 (GRCm39) I1050T unknown Het
Gm32742 G A 9: 51,058,802 (GRCm39) P1072S probably damaging Het
Hdac11 T A 6: 91,145,799 (GRCm39) L151* probably null Het
Iars1 A G 13: 49,841,752 (GRCm39) D80G possibly damaging Het
Kazn T C 4: 141,868,947 (GRCm39) D413G probably damaging Het
Kcnc1 T A 7: 46,077,733 (GRCm39) *512R probably null Het
Kcnf1 G A 12: 17,225,336 (GRCm39) T295I probably benign Het
Klhl9 A G 4: 88,640,205 (GRCm39) V12A probably benign Het
Klk6 T A 7: 43,476,254 (GRCm39) H31Q probably benign Het
Ldhal6b A T 17: 5,468,020 (GRCm39) S305T probably damaging Het
Lta4h C A 10: 93,314,315 (GRCm39) D462E probably damaging Het
Ly75 T G 2: 60,188,903 (GRCm39) R274S probably benign Het
Mideas T C 12: 84,218,380 (GRCm39) T527A probably benign Het
Mn1 A G 5: 111,566,381 (GRCm39) N117S possibly damaging Het
Mrgprd T C 7: 144,875,915 (GRCm39) V262A probably benign Het
Mtres1 A G 10: 43,401,233 (GRCm39) S239P unknown Het
Muc4 C A 16: 32,574,009 (GRCm39) H696N probably benign Het
Nlrp3 A T 11: 59,439,584 (GRCm39) Q387L probably damaging Het
Nme7 A G 1: 164,155,902 (GRCm39) D34G probably damaging Het
Ntrk2 T A 13: 59,007,988 (GRCm39) L250* probably null Het
Or13p8 T C 4: 118,584,224 (GRCm39) V260A probably benign Het
Palld C T 8: 61,968,279 (GRCm39) E1096K probably damaging Het
Pcdh7 A G 5: 57,879,364 (GRCm39) D973G probably benign Het
Pced1a A G 2: 130,264,471 (GRCm39) Y120H probably damaging Het
Pira13 T A 7: 3,824,273 (GRCm39) T627S unknown Het
Pkhd1 A G 1: 20,417,529 (GRCm39) S2541P probably benign Het
Ptcd1 A G 5: 145,102,047 (GRCm39) S91P probably damaging Het
R3hdm1 C T 1: 128,106,833 (GRCm39) R229C probably damaging Het
Sectm1a G T 11: 120,960,701 (GRCm39) T38K probably damaging Het
Serpinb2 A T 1: 107,450,428 (GRCm39) I142F probably damaging Het
Slc25a39 A T 11: 102,295,895 (GRCm39) V112E possibly damaging Het
Snap23 G T 2: 120,415,516 (GRCm39) probably benign Het
Sp8 T A 12: 118,813,122 (GRCm39) Y326N possibly damaging Het
Speer4c2 G A 5: 15,858,598 (GRCm39) R141C probably benign Het
Spock1 A T 13: 57,843,984 (GRCm39) probably null Het
Trpc2 T C 7: 101,745,195 (GRCm39) Y804H probably benign Het
Trpc7 T C 13: 56,952,485 (GRCm39) N562S possibly damaging Het
Trpm6 G A 19: 18,792,799 (GRCm39) G741E probably damaging Het
Vmn1r160 T A 7: 22,570,759 (GRCm39) H37Q probably damaging Het
Vmn1r174 G T 7: 23,453,956 (GRCm39) M207I possibly damaging Het
Zfp521 C A 18: 13,979,137 (GRCm39) L425F probably damaging Het
Other mutations in Gm10272
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01975:Gm10272 APN 10 77,542,608 (GRCm39) missense probably damaging 1.00
IGL03176:Gm10272 APN 10 77,542,467 (GRCm39) missense probably null
R0635:Gm10272 UTSW 10 77,542,535 (GRCm39) intron probably benign
R4209:Gm10272 UTSW 10 77,542,665 (GRCm39) missense possibly damaging 0.95
R7540:Gm10272 UTSW 10 77,542,460 (GRCm39) start codon destroyed unknown
R7887:Gm10272 UTSW 10 77,542,779 (GRCm39) missense probably benign 0.06
R9687:Gm10272 UTSW 10 77,542,764 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AGCCATCTTGCTGTGTGTCC -3'
(R):5'- AGCTAGGTGTGCTTCCAGTC -3'

Sequencing Primer
(F):5'- TGCTGTGTGTCCAGCCC -3'
(R):5'- GGATGAACATGTCCCATTTGCACTG -3'
Posted On 2021-10-11