Incidental Mutation 'R8990:Nlrp3'
ID 684366
Institutional Source Beutler Lab
Gene Symbol Nlrp3
Ensembl Gene ENSMUSG00000032691
Gene Name NLR family, pyrin domain containing 3
Synonyms Mmig1, Cias1, NALP3, cryopyrin, Pypaf1
MMRRC Submission 068822-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R8990 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 59432395-59457781 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 59439584 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 387 (Q387L)
Ref Sequence ENSEMBL: ENSMUSP00000078440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148] [ENSMUST00000149126]
AlphaFold Q8R4B8
Predicted Effect probably damaging
Transcript: ENSMUST00000079476
AA Change: Q387L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: Q387L

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101148
AA Change: Q387L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691
AA Change: Q387L

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149126
SMART Domains Protein: ENSMUSP00000114231
Gene: ENSMUSG00000032691

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
Pfam:FISNA 135 173 1.6e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,104,494 (GRCm39) V731M Het
Ank2 A G 3: 126,841,829 (GRCm39) probably null Het
Ano8 G C 8: 71,929,201 (GRCm39) P1004R unknown Het
Aopep G A 13: 63,304,428 (GRCm39) C480Y probably damaging Het
Asnsd1 C T 1: 53,385,901 (GRCm39) G491D probably damaging Het
Atp6v1c2 A G 12: 17,341,647 (GRCm39) V248A probably benign Het
BC035947 C T 1: 78,475,486 (GRCm39) V349M probably damaging Het
Bcl2l14 A G 6: 134,400,630 (GRCm39) D17G probably damaging Het
Bltp1 T C 3: 36,975,370 (GRCm39) S681P possibly damaging Het
Cbs T C 17: 31,834,523 (GRCm39) T489A probably benign Het
Ccdc66 T C 14: 27,208,655 (GRCm39) K533R probably benign Het
Cenpx A G 11: 120,602,591 (GRCm39) F53S unknown Het
Col4a4 A G 1: 82,473,555 (GRCm39) S657P unknown Het
Csnk2a1 A G 2: 152,096,177 (GRCm39) Y50C probably damaging Het
Ddx60 C T 8: 62,427,168 (GRCm39) R748* probably null Het
Diaph1 A T 18: 37,988,857 (GRCm39) L959H probably damaging Het
Dnaaf5 T G 5: 139,155,951 (GRCm39) L544R probably damaging Het
Dnah10 A G 5: 124,814,057 (GRCm39) D399G Het
Eif2b4 T C 5: 31,347,971 (GRCm39) E247G probably benign Het
Fmnl2 T C 2: 53,016,971 (GRCm39) I1050T unknown Het
Gm10272 T A 10: 77,542,658 (GRCm39) S67T probably damaging Het
Gm32742 G A 9: 51,058,802 (GRCm39) P1072S probably damaging Het
Hdac11 T A 6: 91,145,799 (GRCm39) L151* probably null Het
Iars1 A G 13: 49,841,752 (GRCm39) D80G possibly damaging Het
Kazn T C 4: 141,868,947 (GRCm39) D413G probably damaging Het
Kcnc1 T A 7: 46,077,733 (GRCm39) *512R probably null Het
Kcnf1 G A 12: 17,225,336 (GRCm39) T295I probably benign Het
Klhl9 A G 4: 88,640,205 (GRCm39) V12A probably benign Het
Klk6 T A 7: 43,476,254 (GRCm39) H31Q probably benign Het
Ldhal6b A T 17: 5,468,020 (GRCm39) S305T probably damaging Het
Lta4h C A 10: 93,314,315 (GRCm39) D462E probably damaging Het
Ly75 T G 2: 60,188,903 (GRCm39) R274S probably benign Het
Mideas T C 12: 84,218,380 (GRCm39) T527A probably benign Het
Mn1 A G 5: 111,566,381 (GRCm39) N117S possibly damaging Het
Mrgprd T C 7: 144,875,915 (GRCm39) V262A probably benign Het
Mtres1 A G 10: 43,401,233 (GRCm39) S239P unknown Het
Muc4 C A 16: 32,574,009 (GRCm39) H696N probably benign Het
Nme7 A G 1: 164,155,902 (GRCm39) D34G probably damaging Het
Ntrk2 T A 13: 59,007,988 (GRCm39) L250* probably null Het
Or13p8 T C 4: 118,584,224 (GRCm39) V260A probably benign Het
Palld C T 8: 61,968,279 (GRCm39) E1096K probably damaging Het
Pcdh7 A G 5: 57,879,364 (GRCm39) D973G probably benign Het
Pced1a A G 2: 130,264,471 (GRCm39) Y120H probably damaging Het
Pira13 T A 7: 3,824,273 (GRCm39) T627S unknown Het
Pkhd1 A G 1: 20,417,529 (GRCm39) S2541P probably benign Het
Ptcd1 A G 5: 145,102,047 (GRCm39) S91P probably damaging Het
R3hdm1 C T 1: 128,106,833 (GRCm39) R229C probably damaging Het
Sectm1a G T 11: 120,960,701 (GRCm39) T38K probably damaging Het
Serpinb2 A T 1: 107,450,428 (GRCm39) I142F probably damaging Het
Slc25a39 A T 11: 102,295,895 (GRCm39) V112E possibly damaging Het
Snap23 G T 2: 120,415,516 (GRCm39) probably benign Het
Sp8 T A 12: 118,813,122 (GRCm39) Y326N possibly damaging Het
Speer4c2 G A 5: 15,858,598 (GRCm39) R141C probably benign Het
Spock1 A T 13: 57,843,984 (GRCm39) probably null Het
Trpc2 T C 7: 101,745,195 (GRCm39) Y804H probably benign Het
Trpc7 T C 13: 56,952,485 (GRCm39) N562S possibly damaging Het
Trpm6 G A 19: 18,792,799 (GRCm39) G741E probably damaging Het
Vmn1r160 T A 7: 22,570,759 (GRCm39) H37Q probably damaging Het
Vmn1r174 G T 7: 23,453,956 (GRCm39) M207I possibly damaging Het
Zfp521 C A 18: 13,979,137 (GRCm39) L425F probably damaging Het
Other mutations in Nlrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nlrp3 APN 11 59,456,769 (GRCm39) missense probably damaging 0.99
IGL00573:Nlrp3 APN 11 59,455,942 (GRCm39) missense possibly damaging 0.93
IGL01025:Nlrp3 APN 11 59,442,713 (GRCm39) missense probably benign 0.21
IGL01637:Nlrp3 APN 11 59,440,204 (GRCm39) missense probably damaging 0.99
IGL02010:Nlrp3 APN 11 59,440,361 (GRCm39) missense probably benign
IGL02334:Nlrp3 APN 11 59,455,909 (GRCm39) missense probably benign
IGL02417:Nlrp3 APN 11 59,456,849 (GRCm39) unclassified probably benign
IGL02578:Nlrp3 APN 11 59,439,227 (GRCm39) missense probably damaging 1.00
IGL02710:Nlrp3 APN 11 59,456,802 (GRCm39) missense probably damaging 0.99
IGL02816:Nlrp3 APN 11 59,446,608 (GRCm39) missense probably benign 0.03
IGL03157:Nlrp3 APN 11 59,440,372 (GRCm39) missense possibly damaging 0.80
IGL03334:Nlrp3 APN 11 59,439,842 (GRCm39) missense probably damaging 1.00
Flogiston UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
nd1 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
Nd14 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd3 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
nd5 UTSW 11 59,456,705 (GRCm39) missense probably benign 0.01
nd6 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
nd7 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd9 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
Park2 UTSW 11 59,455,954 (GRCm39) nonsense probably null
Park3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
Park4 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
Park5 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
Park6 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
Park7 UTSW 11 59,438,836 (GRCm39) nonsense probably null
Park8 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0052:Nlrp3 UTSW 11 59,455,954 (GRCm39) nonsense probably null
R0362:Nlrp3 UTSW 11 59,439,623 (GRCm39) missense possibly damaging 0.49
R0416:Nlrp3 UTSW 11 59,446,750 (GRCm39) splice site probably benign
R0649:Nlrp3 UTSW 11 59,439,368 (GRCm39) missense possibly damaging 0.83
R0740:Nlrp3 UTSW 11 59,439,082 (GRCm39) missense probably benign 0.01
R0863:Nlrp3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
R1300:Nlrp3 UTSW 11 59,446,594 (GRCm39) missense possibly damaging 0.86
R1414:Nlrp3 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
R1622:Nlrp3 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
R1654:Nlrp3 UTSW 11 59,433,949 (GRCm39) missense probably benign 0.03
R1715:Nlrp3 UTSW 11 59,434,177 (GRCm39) missense probably damaging 1.00
R1754:Nlrp3 UTSW 11 59,449,228 (GRCm39) missense possibly damaging 0.80
R1837:Nlrp3 UTSW 11 59,439,742 (GRCm39) missense probably benign 0.00
R1905:Nlrp3 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
R2281:Nlrp3 UTSW 11 59,439,962 (GRCm39) missense possibly damaging 0.70
R4296:Nlrp3 UTSW 11 59,440,487 (GRCm39) missense possibly damaging 0.89
R4305:Nlrp3 UTSW 11 59,438,836 (GRCm39) nonsense probably null
R4540:Nlrp3 UTSW 11 59,442,725 (GRCm39) missense possibly damaging 0.83
R4591:Nlrp3 UTSW 11 59,440,048 (GRCm39) missense probably benign 0.00
R4816:Nlrp3 UTSW 11 59,439,127 (GRCm39) missense probably benign 0.32
R4913:Nlrp3 UTSW 11 59,440,064 (GRCm39) missense probably benign 0.09
R4970:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5051:Nlrp3 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R5112:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5185:Nlrp3 UTSW 11 59,455,910 (GRCm39) missense probably benign 0.05
R5417:Nlrp3 UTSW 11 59,439,889 (GRCm39) missense probably damaging 1.00
R5709:Nlrp3 UTSW 11 59,446,574 (GRCm39) nonsense probably null
R5869:Nlrp3 UTSW 11 59,438,960 (GRCm39) missense probably damaging 1.00
R5898:Nlrp3 UTSW 11 59,437,678 (GRCm39) missense probably benign 0.00
R5953:Nlrp3 UTSW 11 59,437,617 (GRCm39) missense probably benign
R5979:Nlrp3 UTSW 11 59,439,797 (GRCm39) missense probably benign 0.06
R6359:Nlrp3 UTSW 11 59,439,392 (GRCm39) missense probably damaging 0.97
R6723:Nlrp3 UTSW 11 59,456,018 (GRCm39) missense probably damaging 1.00
R7261:Nlrp3 UTSW 11 59,439,272 (GRCm39) missense possibly damaging 0.83
R7349:Nlrp3 UTSW 11 59,438,912 (GRCm39) missense probably damaging 1.00
R7388:Nlrp3 UTSW 11 59,455,892 (GRCm39) missense probably benign 0.00
R7715:Nlrp3 UTSW 11 59,433,829 (GRCm39) splice site probably null
R7916:Nlrp3 UTSW 11 59,442,689 (GRCm39) missense probably benign 0.00
R8222:Nlrp3 UTSW 11 59,439,614 (GRCm39) missense probably damaging 0.98
R8360:Nlrp3 UTSW 11 59,440,229 (GRCm39) missense probably benign 0.02
R8390:Nlrp3 UTSW 11 59,442,616 (GRCm39) missense possibly damaging 0.47
R8550:Nlrp3 UTSW 11 59,440,097 (GRCm39) missense probably damaging 1.00
R8738:Nlrp3 UTSW 11 59,440,216 (GRCm39) missense probably benign 0.00
R8940:Nlrp3 UTSW 11 59,455,870 (GRCm39) missense probably benign 0.26
R9324:Nlrp3 UTSW 11 59,434,141 (GRCm39) missense probably damaging 1.00
R9673:Nlrp3 UTSW 11 59,440,148 (GRCm39) missense probably damaging 1.00
RF031:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
RF040:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
Z1088:Nlrp3 UTSW 11 59,442,686 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CGGGGAGACATTCTGCTAAG -3'
(R):5'- AAGAGATGCTCCTCAATGCC -3'

Sequencing Primer
(F):5'- GCTAAGCAGCCTCATCCG -3'
(R):5'- GGGATTGCAGCAGGCTG -3'
Posted On 2021-10-11