Mutagenetix > Incidental Mutation

Incidental Mutation 'R8990:Nlrp3'

684366

Institutional Source

Beutler Lab

Gene Symbol

Nlrp3

Ensembl Gene

ENSMUSG00000032691

Gene Name

NLR family, pyrin domain containing 3

Synonyms

Cias1, cryopyrin, Pypaf1, NALP3, Mmig1

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_145827.3; MGI:2653833

Essential gene?

Probably non essential (E-score: 0.081) question?

Stock #

R8990 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

59541568-59566956 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 59548758 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 387 (Q387L)

Ref Sequence

ENSEMBL: ENSMUSP00000078440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148] [ENSMUST00000149126]

AlphaFold

Q8R4B8

Predicted Effect

probably damaging
Transcript: ENSMUST00000079476
AA Change: Q387L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: Q387L

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
FISNA	135	206	1.45e-22	SMART
Pfam:NACHT	216	385	6.7e-52	PFAM
low complexity region	533	539	N/A	INTRINSIC
low complexity region	688	697	N/A	INTRINSIC
LRR_RI	737	764	1.07e-9	SMART
LRR	766	793	5.13e1	SMART
LRR	794	821	3.86e-7	SMART
LRR	823	850	1.62e0	SMART
LRR	851	878	3.39e-3	SMART
LRR	880	907	1.2e2	SMART
LRR	908	935	2.24e-3	SMART
LRR	937	964	2.16e2	SMART
LRR	965	992	8.73e-6	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000101148
AA Change: Q387L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691
AA Change: Q387L

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
FISNA	135	206	1.45e-22	SMART
Pfam:NACHT	216	385	6.7e-52	PFAM
low complexity region	533	539	N/A	INTRINSIC
low complexity region	688	697	N/A	INTRINSIC
LRR_RI	737	764	1.07e-9	SMART
LRR	766	793	5.13e1	SMART
LRR	794	821	3.86e-7	SMART
LRR	823	850	1.62e0	SMART
LRR	851	878	3.39e-3	SMART
LRR	880	907	1.2e2	SMART
LRR	908	935	2.24e-3	SMART
LRR	937	964	2.16e2	SMART
LRR	965	992	8.73e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000149126

SMART Domains

Protein: ENSMUSP00000114231
Gene: ENSMUSG00000032691

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
Pfam:FISNA	135	173	1.6e-12	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

98% (57/58)

MGI Phenotype

Strain: 3686871
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021F05Rik	A	G	10: 43,525,237	S239P	unknown	Het
2010111I01Rik	G	A	13: 63,156,614	C480Y	probably damaging	Het
4930572O03Rik	G	A	5: 15,653,600	R141C	probably benign	Het
4932438A13Rik	T	C	3: 36,921,221	S681P	possibly damaging	Het
Abcb11	C	T	2: 69,274,150	V731M		Het
Ank2	A	G	3: 127,048,180		probably null	Het
Ano8	G	C	8: 71,476,557	P1004R	unknown	Het
Asnsd1	C	T	1: 53,346,742	G491D	probably damaging	Het
Atp6v1c2	A	G	12: 17,291,646	V248A	probably benign	Het
BC035947	C	T	1: 78,498,849	V349M	probably damaging	Het
Bcl2l14	A	G	6: 134,423,667	D17G	probably damaging	Het
Cbs	T	C	17: 31,615,549	T489A	probably benign	Het
Ccdc66	T	C	14: 27,486,698	K533R	probably benign	Het
Cenpx	A	G	11: 120,711,765	F53S	unknown	Het
Col4a4	A	G	1: 82,495,834	S657P	unknown	Het
Csnk2a1	A	G	2: 152,254,257	Y50C	probably damaging	Het
Ddx60	C	T	8: 61,974,134	R748*	probably null	Het
Diaph1	A	T	18: 37,855,804	L959H	probably damaging	Het
Dnaaf5	T	G	5: 139,170,196	L544R	probably damaging	Het
Dnah10	A	G	5: 124,736,993	D399G		Het
Eif2b4	T	C	5: 31,190,627	E247G	probably benign	Het
Elmsan1	T	C	12: 84,171,606	T527A	probably benign	Het
Fmnl2	T	C	2: 53,126,959	I1050T	unknown	Het
Gm10272	T	A	10: 77,706,824	S67T	probably damaging	Het
Gm15448	T	A	7: 3,821,274	T627S	unknown	Het
Gm32742	G	A	9: 51,147,502	P1072S	probably damaging	Het
Hdac11	T	A	6: 91,168,817	L151*	probably null	Het
Iars	A	G	13: 49,688,276	D80G	possibly damaging	Het
Kazn	T	C	4: 142,141,636	D413G	probably damaging	Het
Kcnc1	T	A	7: 46,428,309	*512R	probably null	Het
Kcnf1	G	A	12: 17,175,335	T295I	probably benign	Het
Klhl9	A	G	4: 88,721,968	V12A	probably benign	Het
Klk6	T	A	7: 43,826,830	H31Q	probably benign	Het
Ldhal6b	A	T	17: 5,417,745	S305T	probably damaging	Het
Lta4h	C	A	10: 93,478,453	D462E	probably damaging	Het
Ly75	T	G	2: 60,358,559	R274S	probably benign	Het
Mn1	A	G	5: 111,418,515	N117S	possibly damaging	Het
Mrgprd	T	C	7: 145,322,178	V262A	probably benign	Het
Muc4	C	A	16: 32,752,209	H696N	probably benign	Het
Nme7	A	G	1: 164,328,333	D34G	probably damaging	Het
Ntrk2	T	A	13: 58,860,174	L250*	probably null	Het
Olfr1340	T	C	4: 118,727,027	V260A	probably benign	Het
Palld	C	T	8: 61,515,245	E1096K	probably damaging	Het
Pcdh7	A	G	5: 57,722,022	D973G	probably benign	Het
Pced1a	A	G	2: 130,422,551	Y120H	probably damaging	Het
Pkhd1	A	G	1: 20,347,305	S2541P	probably benign	Het
Ptcd1	A	G	5: 145,165,237	S91P	probably damaging	Het
R3hdm1	C	T	1: 128,179,096	R229C	probably damaging	Het
Sectm1a	G	T	11: 121,069,875	T38K	probably damaging	Het
Serpinb2	A	T	1: 107,522,698	I142F	probably damaging	Het
Slc25a39	A	T	11: 102,405,069	V112E	possibly damaging	Het
Snap23	G	T	2: 120,585,035		probably benign	Het
Sp8	T	A	12: 118,849,387	Y326N	possibly damaging	Het
Spock1	A	T	13: 57,696,171		probably null	Het
Trpc2	T	C	7: 102,095,988	Y804H	probably benign	Het
Trpc7	T	C	13: 56,804,672	N562S	possibly damaging	Het
Trpm6	G	A	19: 18,815,435	G741E	probably damaging	Het
Vmn1r160	T	A	7: 22,871,334	H37Q	probably damaging	Het
Vmn1r174	G	T	7: 23,754,531	M207I	possibly damaging	Het
Zfp521	C	A	18: 13,846,080	L425F	probably damaging	Het

Other mutations in Nlrp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Nlrp3	APN	11	59565943	missense	probably damaging	0.99
IGL00573:Nlrp3	APN	11	59565116	missense	possibly damaging	0.93
IGL01025:Nlrp3	APN	11	59551887	missense	probably benign	0.21
IGL01637:Nlrp3	APN	11	59549378	missense	probably damaging	0.99
IGL02010:Nlrp3	APN	11	59549535	missense	probably benign
IGL02334:Nlrp3	APN	11	59565083	missense	probably benign
IGL02417:Nlrp3	APN	11	59566023	unclassified	probably benign
IGL02578:Nlrp3	APN	11	59548401	missense	probably damaging	1.00
IGL02710:Nlrp3	APN	11	59565976	missense	probably damaging	0.99
IGL02816:Nlrp3	APN	11	59555782	missense	probably benign	0.03
IGL03157:Nlrp3	APN	11	59549546	missense	possibly damaging	0.80
IGL03334:Nlrp3	APN	11	59549016	missense	probably damaging	1.00
Flogiston	UTSW	11	59558448	missense	probably benign	0.00
nd1	UTSW	11	59565974	missense	probably benign	0.45
Nd14	UTSW	11	59555875	missense	possibly damaging	0.89
Nd3	UTSW	11	59565974	missense	probably benign	0.45
nd5	UTSW	11	59565879	missense	probably benign	0.01
nd6	UTSW	11	59549354	missense	probably damaging	1.00
nd7	UTSW	11	59555875	missense	possibly damaging	0.89
Nd9	UTSW	11	59549354	missense	probably damaging	1.00
Park2	UTSW	11	59565128	nonsense	probably null
Park3	UTSW	11	59565850	missense	probably benign	0.02
Park4	UTSW	11	59549531	missense	probably benign	0.19
Park5	UTSW	11	59548476	missense	probably damaging	0.99
Park6	UTSW	11	59549036	missense	probably damaging	1.00
Park7	UTSW	11	59548010	nonsense	probably null
Park8	UTSW	11	59566199	missense	probably benign	0.19
R0008:Nlrp3	UTSW	11	59558448	missense	probably benign	0.00
R0008:Nlrp3	UTSW	11	59558448	missense	probably benign	0.00
R0052:Nlrp3	UTSW	11	59565128	nonsense	probably null
R0362:Nlrp3	UTSW	11	59548797	missense	possibly damaging	0.49
R0416:Nlrp3	UTSW	11	59555924	splice site	probably benign
R0649:Nlrp3	UTSW	11	59548542	missense	possibly damaging	0.83
R0740:Nlrp3	UTSW	11	59548256	missense	probably benign	0.01
R0863:Nlrp3	UTSW	11	59565850	missense	probably benign	0.02
R1300:Nlrp3	UTSW	11	59555768	missense	possibly damaging	0.86
R1414:Nlrp3	UTSW	11	59549531	missense	probably benign	0.19
R1622:Nlrp3	UTSW	11	59548476	missense	probably damaging	0.99
R1654:Nlrp3	UTSW	11	59543123	missense	probably benign	0.03
R1715:Nlrp3	UTSW	11	59543351	missense	probably damaging	1.00
R1754:Nlrp3	UTSW	11	59558402	missense	possibly damaging	0.80
R1837:Nlrp3	UTSW	11	59548916	missense	probably benign	0.00
R1905:Nlrp3	UTSW	11	59549036	missense	probably damaging	1.00
R2281:Nlrp3	UTSW	11	59549136	missense	possibly damaging	0.70
R4296:Nlrp3	UTSW	11	59549661	missense	possibly damaging	0.89
R4305:Nlrp3	UTSW	11	59548010	nonsense	probably null
R4540:Nlrp3	UTSW	11	59551899	missense	possibly damaging	0.83
R4591:Nlrp3	UTSW	11	59549222	missense	probably benign	0.00
R4816:Nlrp3	UTSW	11	59548301	missense	probably benign	0.32
R4913:Nlrp3	UTSW	11	59549238	missense	probably benign	0.09
R4970:Nlrp3	UTSW	11	59548728	missense	probably damaging	1.00
R5051:Nlrp3	UTSW	11	59566199	missense	probably benign	0.19
R5112:Nlrp3	UTSW	11	59548728	missense	probably damaging	1.00
R5185:Nlrp3	UTSW	11	59565084	missense	probably benign	0.05
R5417:Nlrp3	UTSW	11	59549063	missense	probably damaging	1.00
R5709:Nlrp3	UTSW	11	59555748	nonsense	probably null
R5869:Nlrp3	UTSW	11	59548134	missense	probably damaging	1.00
R5898:Nlrp3	UTSW	11	59546852	missense	probably benign	0.00
R5953:Nlrp3	UTSW	11	59546791	missense	probably benign
R5979:Nlrp3	UTSW	11	59548971	missense	probably benign	0.06
R6359:Nlrp3	UTSW	11	59548566	missense	probably damaging	0.97
R6723:Nlrp3	UTSW	11	59565192	missense	probably damaging	1.00
R7261:Nlrp3	UTSW	11	59548446	missense	possibly damaging	0.83
R7349:Nlrp3	UTSW	11	59548086	missense	probably damaging	1.00
R7388:Nlrp3	UTSW	11	59565066	missense	probably benign	0.00
R7715:Nlrp3	UTSW	11	59543003	splice site	probably null
R7916:Nlrp3	UTSW	11	59551863	missense	probably benign	0.00
R8222:Nlrp3	UTSW	11	59548788	missense	probably damaging	0.98
R8360:Nlrp3	UTSW	11	59549403	missense	probably benign	0.02
R8390:Nlrp3	UTSW	11	59551790	missense	possibly damaging	0.47
R8550:Nlrp3	UTSW	11	59549271	missense	probably damaging	1.00
R8738:Nlrp3	UTSW	11	59549390	missense	probably benign	0.00
R8940:Nlrp3	UTSW	11	59565044	missense	probably benign	0.26
R9324:Nlrp3	UTSW	11	59543315	missense	probably damaging	1.00
R9673:Nlrp3	UTSW	11	59549322	missense	probably damaging	1.00
RF031:Nlrp3	UTSW	11	59558552	frame shift	probably null
RF040:Nlrp3	UTSW	11	59558552	frame shift	probably null
Z1088:Nlrp3	UTSW	11	59551860	missense	possibly damaging	0.67

Predicted Primers

PCR Primer
(F):5'- CGGGGAGACATTCTGCTAAG -3'
(R):5'- AAGAGATGCTCCTCAATGCC -3'

Sequencing Primer
(F):5'- GCTAAGCAGCCTCATCCG -3'
(R):5'- GGGATTGCAGCAGGCTG -3'

Posted On

2021-10-11