Mutagenetix > Incidental Mutation

Incidental Mutation 'R8991:Cic'

684405

Institutional Source

Beutler Lab

Gene Symbol

Cic

Ensembl Gene

ENSMUSG00000005442

Gene Name

capicua transcriptional repressor

Synonyms

1200010B10Rik

MMRRC Submission

068716-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.943) question?

Stock #

R8991 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

24967129-24993584 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 24988885 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 1829 (V1829D)

Ref Sequence

ENSEMBL: ENSMUSP00000132351 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005578] [ENSMUST00000163320] [ENSMUST00000164820] [ENSMUST00000165239] [ENSMUST00000169266]

AlphaFold

Q924A2

Predicted Effect

probably damaging
Transcript: ENSMUST00000005578
AA Change: V922D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000005578
Gene: ENSMUSG00000005442
AA Change: V922D

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	6e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1065	1080	N/A	INTRINSIC
low complexity region	1118	1132	N/A	INTRINSIC
low complexity region	1135	1155	N/A	INTRINSIC
low complexity region	1223	1253	N/A	INTRINSIC
low complexity region	1280	1313	N/A	INTRINSIC
low complexity region	1405	1418	N/A	INTRINSIC
low complexity region	1483	1494	N/A	INTRINSIC
low complexity region	1524	1547	N/A	INTRINSIC
low complexity region	1568	1603	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000163320
AA Change: V922D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000126659
Gene: ENSMUSG00000005442
AA Change: V922D

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	6e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1064	1079	N/A	INTRINSIC
low complexity region	1117	1131	N/A	INTRINSIC
low complexity region	1134	1154	N/A	INTRINSIC
low complexity region	1222	1252	N/A	INTRINSIC
low complexity region	1279	1312	N/A	INTRINSIC
low complexity region	1405	1418	N/A	INTRINSIC
low complexity region	1483	1494	N/A	INTRINSIC
low complexity region	1524	1547	N/A	INTRINSIC
low complexity region	1568	1603	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163901

SMART Domains

Protein: ENSMUSP00000127858
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
low complexity region	24	35	N/A	INTRINSIC
low complexity region	114	128	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164820

SMART Domains

Protein: ENSMUSP00000130146
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
low complexity region	22	36	N/A	INTRINSIC
low complexity region	39	57	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000165239
AA Change: V922D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000128071
Gene: ENSMUSG00000005442
AA Change: V922D

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	5e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1065	1080	N/A	INTRINSIC
low complexity region	1118	1132	N/A	INTRINSIC
low complexity region	1135	1153	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169266
AA Change: V1829D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442
AA Change: V1829D

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
low complexity region	33	73	N/A	INTRINSIC
low complexity region	151	165	N/A	INTRINSIC
Pfam:DUF4819	249	346	1.8e-23	PFAM
low complexity region	351	367	N/A	INTRINSIC
low complexity region	403	427	N/A	INTRINSIC
low complexity region	445	457	N/A	INTRINSIC
low complexity region	462	475	N/A	INTRINSIC
low complexity region	618	633	N/A	INTRINSIC
low complexity region	673	685	N/A	INTRINSIC
low complexity region	724	734	N/A	INTRINSIC
low complexity region	740	751	N/A	INTRINSIC
low complexity region	779	786	N/A	INTRINSIC
low complexity region	858	883	N/A	INTRINSIC
low complexity region	898	911	N/A	INTRINSIC
PDB:4J2L\|D	930	955	5e-10	PDB
low complexity region	1013	1027	N/A	INTRINSIC
low complexity region	1031	1045	N/A	INTRINSIC
HMG	1106	1176	1.24e-17	SMART
low complexity region	1322	1338	N/A	INTRINSIC
low complexity region	1380	1393	N/A	INTRINSIC
low complexity region	1415	1428	N/A	INTRINSIC
low complexity region	1432	1462	N/A	INTRINSIC
low complexity region	1474	1490	N/A	INTRINSIC
low complexity region	1552	1567	N/A	INTRINSIC
low complexity region	1636	1647	N/A	INTRINSIC
low complexity region	1689	1710	N/A	INTRINSIC
low complexity region	1744	1766	N/A	INTRINSIC
low complexity region	1846	1858	N/A	INTRINSIC
low complexity region	1971	1986	N/A	INTRINSIC
low complexity region	2024	2038	N/A	INTRINSIC
low complexity region	2041	2061	N/A	INTRINSIC
low complexity region	2129	2159	N/A	INTRINSIC
low complexity region	2186	2219	N/A	INTRINSIC
low complexity region	2311	2324	N/A	INTRINSIC
low complexity region	2389	2400	N/A	INTRINSIC
low complexity region	2430	2453	N/A	INTRINSIC
low complexity region	2474	2509	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]

Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921524L21Rik	A	T	18: 6,620,232 (GRCm39)	K54I	probably damaging	Het
Ankrd34b	T	A	13: 92,575,725 (GRCm39)	I319K	probably benign	Het
Art2b	G	A	7: 101,229,590 (GRCm39)	A103V	probably damaging	Het
Atmin	T	G	8: 117,679,665 (GRCm39)	F126C	probably damaging	Het
Cc2d1b	A	T	4: 108,482,143 (GRCm39)	N139I	probably benign	Het
Cep128	T	C	12: 91,200,987 (GRCm39)	Y794C	probably damaging	Het
Cnep1r1	G	A	8: 88,856,447 (GRCm39)	R99Q	unknown	Het
Cpq	G	C	15: 33,213,353 (GRCm39)	R124P	probably damaging	Het
Crtc3	A	T	7: 80,327,191 (GRCm39)	V45D	probably damaging	Het
Dchs2	T	G	3: 83,036,143 (GRCm39)	S297A	probably benign	Het
Dnah9	A	T	11: 65,777,506 (GRCm39)	S3681T	probably damaging	Het
Dock8	T	C	19: 25,165,731 (GRCm39)	Y1872H	possibly damaging	Het
Fbn2	T	A	18: 58,239,395 (GRCm39)	Q558L	probably damaging	Het
Fn1	A	G	1: 71,676,491 (GRCm39)	V580A	probably benign	Het
Fscn3	C	T	6: 28,434,472 (GRCm39)	T349I	probably benign	Het
Fsip2	T	C	2: 82,815,370 (GRCm39)	V3701A	probably benign	Het
Hectd4	T	C	5: 121,496,347 (GRCm39)	V3913A	probably benign	Het
Htt	G	A	5: 35,063,062 (GRCm39)	G2898D	probably damaging	Het
Ighv3-4	T	G	12: 114,217,266 (GRCm39)	E108D	probably benign	Het
Irx5	G	T	8: 93,087,135 (GRCm39)	E356*	probably null	Het
Kcnh6	A	G	11: 105,909,971 (GRCm39)	I499V	possibly damaging	Het
Kcnj10	T	A	1: 172,196,963 (GRCm39)	I159N	probably damaging	Het
Kcnmb4	T	A	10: 116,282,238 (GRCm39)	H153L	probably benign	Het
Klhl8	T	C	5: 104,018,404 (GRCm39)	N409S	probably benign	Het
Ksr1	A	G	11: 78,936,014 (GRCm39)	S117P	probably benign	Het
Lrfn3	A	T	7: 30,059,244 (GRCm39)	V327E	probably damaging	Het
Mrc2	C	A	11: 105,229,740 (GRCm39)	H724Q	probably benign	Het
Mtf2	T	A	5: 108,248,805 (GRCm39)	F372L	probably benign	Het
Nipbl	A	T	15: 8,320,997 (GRCm39)	D2703E	probably damaging	Het
Nova1	T	C	12: 46,863,800 (GRCm39)	Y50C	unknown	Het
Ofcc1	T	A	13: 40,296,277 (GRCm39)	Y519F	probably benign	Het
Or2aj5	T	A	16: 19,424,511 (GRCm39)	K301N	probably damaging	Het
Or4f54	T	C	2: 111,123,348 (GRCm39)	I245T	probably damaging	Het
Or4f61	A	T	2: 111,922,682 (GRCm39)	D121E	probably damaging	Het
Or4p19	A	C	2: 88,242,723 (GRCm39)	M93R	probably damaging	Het
Pclo	C	T	5: 14,719,325 (GRCm39)	A1154V	unknown	Het
Phrf1	A	G	7: 140,823,671 (GRCm39)	D4G	unknown	Het
Ppp4r3b	A	T	11: 29,123,306 (GRCm39)	M1L	probably damaging	Het
Prmt7	A	G	8: 106,943,874 (GRCm39)		probably null	Het
Retnlg	A	G	16: 48,694,038 (GRCm39)	T65A	possibly damaging	Het
Sbf2	T	C	7: 109,911,896 (GRCm39)	N1763D	probably benign	Het
Scn7a	A	G	2: 66,514,588 (GRCm39)	F1062S	possibly damaging	Het
Scube3	A	C	17: 28,383,027 (GRCm39)	K402Q	probably damaging	Het
Skic2	T	A	17: 35,059,166 (GRCm39)	D1067V	probably damaging	Het
Slc25a22	C	A	7: 141,013,871 (GRCm39)	D30Y	probably damaging	Het
Smim17	A	T	7: 6,427,720 (GRCm39)	Q2L	possibly damaging	Het
Son	G	T	16: 91,453,366 (GRCm39)	M704I	probably benign	Het
Son	C	T	16: 91,453,608 (GRCm39)	S785F	possibly damaging	Het
Tnfrsf21	G	A	17: 43,396,299 (GRCm39)	V528M	probably benign	Het
Tnks1bp1	T	C	2: 84,894,290 (GRCm39)	S1406P	probably benign	Het
Trim21	A	T	7: 102,212,908 (GRCm39)	V130E	probably benign	Het
Try5	T	A	6: 41,289,295 (GRCm39)	I94F	probably benign	Het
Tubb4a	C	T	17: 57,388,169 (GRCm39)	V286I	probably benign	Het
Vmn1r180	T	A	7: 23,652,076 (GRCm39)	S80T	probably benign	Het
Vmn2r114	A	C	17: 23,529,286 (GRCm39)	I272S	probably damaging	Het
Vmn2r12	A	T	5: 109,234,033 (GRCm39)	Y726*	probably null	Het
Zdhhc16	T	C	19: 41,926,465 (GRCm39)	F83L	probably damaging	Het
Zfp521	C	A	18: 13,979,137 (GRCm39)	L425F	probably damaging	Het

Other mutations in Cic

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Cic	APN	7	24,991,549 (GRCm39)	missense	probably damaging	1.00
IGL01668:Cic	APN	7	24,990,629 (GRCm39)	missense	possibly damaging	0.47
IGL02229:Cic	APN	7	24,990,375 (GRCm39)	missense	probably damaging	0.96
IGL02506:Cic	APN	7	24,990,282 (GRCm39)	missense	probably benign
IGL02794:Cic	APN	7	24,985,069 (GRCm39)	missense	probably damaging	1.00
IGL03065:Cic	APN	7	24,985,246 (GRCm39)	splice site	probably benign
IGL03304:Cic	APN	7	24,984,274 (GRCm39)	missense	probably damaging	1.00
Capuccino	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
Cassock	UTSW	7	24,988,338 (GRCm39)	nonsense	probably null
Monkey	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R4850_Cic_466	UTSW	7	24,972,327 (GRCm39)	missense	probably damaging	0.98
1mM(1):Cic	UTSW	7	24,990,214 (GRCm39)	splice site	probably benign
IGL03046:Cic	UTSW	7	24,990,500 (GRCm39)	missense	probably damaging	1.00
R0012:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0012:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0027:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0027:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0038:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0038:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0063:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0063:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0064:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0064:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0118:Cic	UTSW	7	24,985,459 (GRCm39)	missense	probably damaging	1.00
R0193:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0193:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0241:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0241:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0377:Cic	UTSW	7	24,985,224 (GRCm39)	missense	probably damaging	0.98
R0462:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0462:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0800:Cic	UTSW	7	24,984,662 (GRCm39)	missense	probably benign
R1253:Cic	UTSW	7	24,990,373 (GRCm39)	missense	probably damaging	1.00
R1458:Cic	UTSW	7	24,979,162 (GRCm39)	intron	probably benign
R1462:Cic	UTSW	7	24,971,032 (GRCm39)	missense	probably damaging	0.98
R1462:Cic	UTSW	7	24,971,032 (GRCm39)	missense	probably damaging	0.98
R1519:Cic	UTSW	7	24,993,235 (GRCm39)	critical splice acceptor site	probably null
R1586:Cic	UTSW	7	24,985,386 (GRCm39)	missense	probably damaging	1.00
R1824:Cic	UTSW	7	24,987,691 (GRCm39)	missense	probably damaging	1.00
R1908:Cic	UTSW	7	24,986,265 (GRCm39)	missense	probably damaging	1.00
R2045:Cic	UTSW	7	24,970,961 (GRCm39)	missense	possibly damaging	0.53
R2063:Cic	UTSW	7	24,972,876 (GRCm39)	missense	probably damaging	0.98
R2161:Cic	UTSW	7	24,987,559 (GRCm39)	splice site	probably null
R2495:Cic	UTSW	7	24,991,201 (GRCm39)	splice site	probably benign
R2865:Cic	UTSW	7	24,972,646 (GRCm39)	missense	probably damaging	0.96
R3692:Cic	UTSW	7	24,988,338 (GRCm39)	nonsense	probably null
R3709:Cic	UTSW	7	24,986,406 (GRCm39)	missense	probably damaging	0.99
R3710:Cic	UTSW	7	24,986,406 (GRCm39)	missense	probably damaging	0.99
R3872:Cic	UTSW	7	24,971,124 (GRCm39)	missense	possibly damaging	0.92
R3946:Cic	UTSW	7	24,971,771 (GRCm39)	missense	possibly damaging	0.93
R4199:Cic	UTSW	7	24,991,095 (GRCm39)	frame shift	probably null
R4426:Cic	UTSW	7	24,993,433 (GRCm39)	utr 3 prime	probably benign
R4502:Cic	UTSW	7	24,987,892 (GRCm39)	missense	probably damaging	1.00
R4585:Cic	UTSW	7	24,972,203 (GRCm39)	missense	probably benign	0.33
R4586:Cic	UTSW	7	24,972,203 (GRCm39)	missense	probably benign	0.33
R4614:Cic	UTSW	7	24,991,095 (GRCm39)	frame shift	probably null
R4664:Cic	UTSW	7	24,990,099 (GRCm39)	small deletion	probably benign
R4688:Cic	UTSW	7	24,991,095 (GRCm39)	frame shift	probably null
R4695:Cic	UTSW	7	24,973,013 (GRCm39)	missense	possibly damaging	0.72
R4696:Cic	UTSW	7	24,987,908 (GRCm39)	missense	probably benign
R4746:Cic	UTSW	7	24,987,905 (GRCm39)	missense	probably damaging	1.00
R4758:Cic	UTSW	7	24,991,636 (GRCm39)	missense	possibly damaging	0.62
R4767:Cic	UTSW	7	24,971,025 (GRCm39)	missense	possibly damaging	0.92
R4776:Cic	UTSW	7	24,982,308 (GRCm39)	missense	possibly damaging	0.95
R4820:Cic	UTSW	7	24,971,157 (GRCm39)	missense	possibly damaging	0.92
R4850:Cic	UTSW	7	24,972,327 (GRCm39)	missense	probably damaging	0.98
R4851:Cic	UTSW	7	24,972,327 (GRCm39)	missense	probably damaging	0.98
R4922:Cic	UTSW	7	24,991,095 (GRCm39)	small insertion	probably benign
R4989:Cic	UTSW	7	24,986,535 (GRCm39)	missense	probably damaging	1.00
R5131:Cic	UTSW	7	24,991,095 (GRCm39)	small insertion	probably benign
R5718:Cic	UTSW	7	24,972,203 (GRCm39)	missense	probably benign	0.33
R5801:Cic	UTSW	7	24,970,863 (GRCm39)	missense	possibly damaging	0.93
R5949:Cic	UTSW	7	24,971,730 (GRCm39)	missense	probably damaging	1.00
R6000:Cic	UTSW	7	24,971,423 (GRCm39)	missense	probably benign	0.33
R6246:Cic	UTSW	7	24,971,067 (GRCm39)	missense	probably damaging	1.00
R6283:Cic	UTSW	7	24,985,459 (GRCm39)	missense	probably damaging	1.00
R6364:Cic	UTSW	7	24,972,248 (GRCm39)	missense	possibly damaging	0.72
R6481:Cic	UTSW	7	24,987,706 (GRCm39)	missense	possibly damaging	0.56
R6919:Cic	UTSW	7	24,971,202 (GRCm39)	missense	probably benign	0.04
R6920:Cic	UTSW	7	24,990,107 (GRCm39)	missense	probably damaging	1.00
R6995:Cic	UTSW	7	24,970,736 (GRCm39)	missense	possibly damaging	0.53
R7002:Cic	UTSW	7	24,971,621 (GRCm39)	missense	probably damaging	0.99
R7113:Cic	UTSW	7	24,972,869 (GRCm39)	missense	probably benign	0.08
R7560:Cic	UTSW	7	24,972,278 (GRCm39)	missense	probably damaging	0.98
R7680:Cic	UTSW	7	24,991,856 (GRCm39)	missense	probably damaging	0.96
R7698:Cic	UTSW	7	24,972,597 (GRCm39)	missense	possibly damaging	0.72
R7746:Cic	UTSW	7	24,988,207 (GRCm39)	missense	probably damaging	1.00
R7841:Cic	UTSW	7	24,985,192 (GRCm39)	missense	probably damaging	1.00
R7879:Cic	UTSW	7	24,984,551 (GRCm39)	missense	probably benign	0.10
R7916:Cic	UTSW	7	24,987,715 (GRCm39)	missense	probably damaging	0.99
R7920:Cic	UTSW	7	24,971,384 (GRCm39)	missense	probably benign
R8056:Cic	UTSW	7	24,990,366 (GRCm39)	missense	possibly damaging	0.90
R8226:Cic	UTSW	7	24,987,213 (GRCm39)	missense	probably damaging	1.00
R8281:Cic	UTSW	7	24,971,249 (GRCm39)	missense	probably benign
R8847:Cic	UTSW	7	24,970,631 (GRCm39)	missense	probably damaging	0.98
R9083:Cic	UTSW	7	24,985,470 (GRCm39)	missense	probably damaging	0.99
R9140:Cic	UTSW	7	24,985,165 (GRCm39)	missense	probably damaging	0.99
R9200:Cic	UTSW	7	24,971,940 (GRCm39)	missense	probably damaging	0.99
R9208:Cic	UTSW	7	24,987,502 (GRCm39)	missense	probably benign	0.07
R9301:Cic	UTSW	7	24,991,117 (GRCm39)	missense	probably damaging	1.00
R9408:Cic	UTSW	7	24,971,414 (GRCm39)	missense	possibly damaging	0.70
R9569:Cic	UTSW	7	24,972,120 (GRCm39)	missense	possibly damaging	0.85
R9752:Cic	UTSW	7	24,971,403 (GRCm39)	missense	probably damaging	0.96
V7732:Cic	UTSW	7	24,991,670 (GRCm39)	missense	probably benign
Z1176:Cic	UTSW	7	24,970,444 (GRCm39)	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- AGTACATCCTGCCCACACTG -3'
(R):5'- ATGACACCCATCAGTGCAG -3'

Sequencing Primer
(F):5'- AGCAGCTTCAAGTGGCAC -3'
(R):5'- TGACACCCATCAGTGCAGAGAAG -3'

Posted On

2021-10-11