Incidental Mutation 'R8991:Tnfrsf21'
ID684437
Institutional Source Beutler Lab
Gene Symbol Tnfrsf21
Ensembl Gene ENSMUSG00000023915
Gene Nametumor necrosis factor receptor superfamily, member 21
SynonymsDR6, TR7, Death receptor 6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R8991 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location43016555-43089188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 43085408 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 528 (V528M)
Ref Sequence ENSEMBL: ENSMUSP00000024708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024708]
Predicted Effect probably benign
Transcript: ENSMUST00000024708
AA Change: V528M

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000024708
Gene: ENSMUSG00000023915
AA Change: V528M

DomainStartEndE-ValueType
TNFR 50 88 1.58e1 SMART
TNFR 91 131 3.42e-3 SMART
TNFR 133 168 9.31e-5 SMART
TNFR 171 211 1.1e-1 SMART
transmembrane domain 351 370 N/A INTRINSIC
DEATH 393 498 1.41e-22 SMART
low complexity region 511 526 N/A INTRINSIC
low complexity region 562 575 N/A INTRINSIC
PDB:2DBH|A 576 655 5e-48 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The encoded protein activates nuclear factor kappa-B and mitogen-activated protein kinase 8 (also called c-Jun N-terminal kinase 1), and induces cell apoptosis. Through its death domain, the encoded receptor interacts with tumor necrosis factor receptor type 1-associated death domain (TRADD) protein, which is known to mediate signal transduction of tumor necrosis factor receptors. Knockout studies in mice suggest that this gene plays a role in T-helper cell activation, and may be involved in inflammation and immune regulation. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired T cell differentiation and an enhanced Th2 response. Mice homozygous for a different knock-out allele show increased CD4+ T cell proliferation and Th2 cytokine production, and enhanced B cell proliferation, survival, and humoral responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,620,232 K54I probably damaging Het
Ankrd34b T A 13: 92,439,217 I319K probably benign Het
Art2b G A 7: 101,580,383 A103V probably damaging Het
Atmin T G 8: 116,952,926 F126C probably damaging Het
Cc2d1b A T 4: 108,624,946 N139I probably benign Het
Cep128 T C 12: 91,234,213 Y794C probably damaging Het
Cic T A 7: 25,289,460 V1829D probably damaging Het
Cnep1r1 G A 8: 88,129,819 R99Q unknown Het
Cpq G C 15: 33,213,207 R124P probably damaging Het
Crtc3 A T 7: 80,677,443 V45D probably damaging Het
Dchs2 T G 3: 83,128,836 S297A probably benign Het
Dnah9 A T 11: 65,886,680 S3681T probably damaging Het
Dock8 T C 19: 25,188,367 Y1872H possibly damaging Het
Fbn2 T A 18: 58,106,323 Q558L probably damaging Het
Fn1 A G 1: 71,637,332 V580A probably benign Het
Fscn3 C T 6: 28,434,473 T349I probably benign Het
Fsip2 T C 2: 82,985,026 V3701A probably benign Het
Hectd4 T C 5: 121,358,284 V3913A probably benign Het
Htt G A 5: 34,905,718 G2898D probably damaging Het
Ighv3-4 T G 12: 114,253,646 E108D probably benign Het
Irx5 G T 8: 92,360,507 E356* probably null Het
Kcnh6 A G 11: 106,019,145 I499V possibly damaging Het
Kcnj10 T A 1: 172,369,396 I159N probably damaging Het
Kcnmb4 T A 10: 116,446,333 H153L probably benign Het
Klhl8 T C 5: 103,870,538 N409S probably benign Het
Ksr1 A G 11: 79,045,188 S117P probably benign Het
Lrfn3 A T 7: 30,359,819 V327E probably damaging Het
Mrc2 C A 11: 105,338,914 H724Q probably benign Het
Mtf2 T A 5: 108,100,939 F372L probably benign Het
Nipbl A T 15: 8,291,513 D2703E probably damaging Het
Nova1 T C 12: 46,817,017 Y50C unknown Het
Ofcc1 T A 13: 40,142,801 Y519F probably benign Het
Olfr1180 A C 2: 88,412,379 M93R probably damaging Het
Olfr1278 T C 2: 111,293,003 I245T probably damaging Het
Olfr1314 A T 2: 112,092,337 D121E probably damaging Het
Olfr170 T A 16: 19,605,761 K301N probably damaging Het
Pclo C T 5: 14,669,311 A1154V unknown Het
Phrf1 A G 7: 141,243,758 D4G unknown Het
Ppp4r3b A T 11: 29,173,306 M1L probably damaging Het
Prmt7 A G 8: 106,217,242 probably null Het
Retnlg A G 16: 48,873,675 T65A possibly damaging Het
Sbf2 T C 7: 110,312,689 N1763D probably benign Het
Scn7a A G 2: 66,684,244 F1062S possibly damaging Het
Scube3 A C 17: 28,164,053 K402Q probably damaging Het
Skiv2l T A 17: 34,840,190 D1067V probably damaging Het
Slc25a22 C A 7: 141,433,958 D30Y probably damaging Het
Smim17 A T 7: 6,424,721 Q2L possibly damaging Het
Son G T 16: 91,656,478 M704I probably benign Het
Son C T 16: 91,656,720 S785F possibly damaging Het
Tnks1bp1 T C 2: 85,063,946 S1406P probably benign Het
Trim21 A T 7: 102,563,701 V130E probably benign Het
Try5 T A 6: 41,312,361 I94F probably benign Het
Tubb4a C T 17: 57,081,169 V286I probably benign Het
Vmn1r180 T A 7: 23,952,651 S80T probably benign Het
Vmn2r114 A C 17: 23,310,312 I272S probably damaging Het
Vmn2r12 A T 5: 109,086,167 Y726* probably null Het
Zdhhc16 T C 19: 41,938,026 F83L probably damaging Het
Zfp521 C A 18: 13,846,080 L425F probably damaging Het
Other mutations in Tnfrsf21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Tnfrsf21 APN 17 43037946 missense probably damaging 1.00
IGL01663:Tnfrsf21 APN 17 43087811 missense probably benign 0.13
IGL01811:Tnfrsf21 APN 17 43037613 missense probably benign
IGL01916:Tnfrsf21 APN 17 43039803 missense probably benign 0.00
IGL01934:Tnfrsf21 APN 17 43065187 missense probably benign 0.15
IGL02184:Tnfrsf21 APN 17 43085463 missense probably benign 0.37
IGL02292:Tnfrsf21 APN 17 43039911 missense probably benign
IGL02385:Tnfrsf21 APN 17 43040051 missense probably damaging 1.00
IGL02710:Tnfrsf21 APN 17 43087929 missense probably damaging 0.97
IGL03001:Tnfrsf21 APN 17 43087895 missense probably damaging 0.99
IGL03003:Tnfrsf21 APN 17 43039943 missense probably damaging 1.00
PIT4480001:Tnfrsf21 UTSW 17 43037911 missense probably benign 0.00
R0007:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0046:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0088:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0091:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0102:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0102:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0103:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0105:Tnfrsf21 UTSW 17 43040191 critical splice donor site probably null
R0105:Tnfrsf21 UTSW 17 43040191 critical splice donor site probably null
R0206:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0211:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0240:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0243:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0308:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0363:Tnfrsf21 UTSW 17 43037877 missense probably benign 0.01
R0456:Tnfrsf21 UTSW 17 43038091 missense probably benign 0.01
R0522:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0523:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0525:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0528:Tnfrsf21 UTSW 17 43037614 missense probably benign
R0543:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0549:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0550:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0699:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0724:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0734:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0847:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0880:Tnfrsf21 UTSW 17 43037842 nonsense probably null
R1591:Tnfrsf21 UTSW 17 43085374 missense probably benign 0.01
R2069:Tnfrsf21 UTSW 17 43037938 missense possibly damaging 0.67
R2153:Tnfrsf21 UTSW 17 43087872 missense probably damaging 1.00
R2323:Tnfrsf21 UTSW 17 43085529 nonsense probably null
R3941:Tnfrsf21 UTSW 17 43038010 missense probably damaging 1.00
R4438:Tnfrsf21 UTSW 17 43087842 missense possibly damaging 0.49
R4509:Tnfrsf21 UTSW 17 43085388 missense probably benign 0.00
R4510:Tnfrsf21 UTSW 17 43065019 missense probably damaging 0.98
R4511:Tnfrsf21 UTSW 17 43065019 missense probably damaging 0.98
R4708:Tnfrsf21 UTSW 17 43038232 missense possibly damaging 0.66
R4721:Tnfrsf21 UTSW 17 43085504 missense probably damaging 1.00
R4811:Tnfrsf21 UTSW 17 43037730 missense probably benign 0.00
R5437:Tnfrsf21 UTSW 17 43037862 missense possibly damaging 0.55
R5767:Tnfrsf21 UTSW 17 43037659 missense probably damaging 0.98
R6057:Tnfrsf21 UTSW 17 43039715 missense possibly damaging 0.86
R6392:Tnfrsf21 UTSW 17 43017088 missense probably benign 0.00
R6860:Tnfrsf21 UTSW 17 43017066 missense probably benign
R7253:Tnfrsf21 UTSW 17 43037667 missense probably benign 0.00
R7288:Tnfrsf21 UTSW 17 43037818 missense possibly damaging 0.86
R7643:Tnfrsf21 UTSW 17 43037916 missense probably benign 0.00
R7937:Tnfrsf21 UTSW 17 43037925 missense probably benign 0.01
R8098:Tnfrsf21 UTSW 17 43039899 missense probably benign
R8495:Tnfrsf21 UTSW 17 43038237 missense probably benign
R8865:Tnfrsf21 UTSW 17 43085481 missense probably damaging 1.00
V3553:Tnfrsf21 UTSW 17 43037931 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACACGAACTCTGAAAGGGTTC -3'
(R):5'- TCAGCTACAACTGGGCTGTG -3'

Sequencing Primer
(F):5'- CTCGCTTGAGCTTCATAGTAAGAC -3'
(R):5'- CTACAACTGGGCTGTGGGAGTG -3'
Posted On2021-10-11