Mutagenetix > Incidental Mutation

Incidental Mutation 'R8991:Tnfrsf21'

684437

Institutional Source

Beutler Lab

Gene Symbol

Tnfrsf21

Ensembl Gene

ENSMUSG00000023915

Gene Name

tumor necrosis factor receptor superfamily, member 21

Synonyms

DR6, TR7, Death receptor 6

MMRRC Submission

068716-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.182) question?

Stock #

R8991 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

43016555-43089188 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 43085408 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 528 (V528M)

Ref Sequence

ENSEMBL: ENSMUSP00000024708 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024708]

AlphaFold

Q9EPU5

Predicted Effect

probably benign
Transcript: ENSMUST00000024708
AA Change: V528M

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000024708
Gene: ENSMUSG00000023915
AA Change: V528M

Domain	Start	End	E-Value	Type
TNFR	50	88	1.58e1	SMART
TNFR	91	131	3.42e-3	SMART
TNFR	133	168	9.31e-5	SMART
TNFR	171	211	1.1e-1	SMART
transmembrane domain	351	370	N/A	INTRINSIC
DEATH	393	498	1.41e-22	SMART
low complexity region	511	526	N/A	INTRINSIC
low complexity region	562	575	N/A	INTRINSIC
PDB:2DBH\|A	576	655	5e-48	PDB

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The encoded protein activates nuclear factor kappa-B and mitogen-activated protein kinase 8 (also called c-Jun N-terminal kinase 1), and induces cell apoptosis. Through its death domain, the encoded receptor interacts with tumor necrosis factor receptor type 1-associated death domain (TRADD) protein, which is known to mediate signal transduction of tumor necrosis factor receptors. Knockout studies in mice suggest that this gene plays a role in T-helper cell activation, and may be involved in inflammation and immune regulation. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired T cell differentiation and an enhanced Th2 response. Mice homozygous for a different knock-out allele show increased CD4+ T cell proliferation and Th2 cytokine production, and enhanced B cell proliferation, survival, and humoral responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921524L21Rik	A	T	18: 6,620,232	K54I	probably damaging	Het
Ankrd34b	T	A	13: 92,439,217	I319K	probably benign	Het
Art2b	G	A	7: 101,580,383	A103V	probably damaging	Het
Atmin	T	G	8: 116,952,926	F126C	probably damaging	Het
Cc2d1b	A	T	4: 108,624,946	N139I	probably benign	Het
Cep128	T	C	12: 91,234,213	Y794C	probably damaging	Het
Cic	T	A	7: 25,289,460	V1829D	probably damaging	Het
Cnep1r1	G	A	8: 88,129,819	R99Q	unknown	Het
Cpq	G	C	15: 33,213,207	R124P	probably damaging	Het
Crtc3	A	T	7: 80,677,443	V45D	probably damaging	Het
Dchs2	T	G	3: 83,128,836	S297A	probably benign	Het
Dnah9	A	T	11: 65,886,680	S3681T	probably damaging	Het
Dock8	T	C	19: 25,188,367	Y1872H	possibly damaging	Het
Fbn2	T	A	18: 58,106,323	Q558L	probably damaging	Het
Fn1	A	G	1: 71,637,332	V580A	probably benign	Het
Fscn3	C	T	6: 28,434,473	T349I	probably benign	Het
Fsip2	T	C	2: 82,985,026	V3701A	probably benign	Het
Hectd4	T	C	5: 121,358,284	V3913A	probably benign	Het
Htt	G	A	5: 34,905,718	G2898D	probably damaging	Het
Ighv3-4	T	G	12: 114,253,646	E108D	probably benign	Het
Irx5	G	T	8: 92,360,507	E356*	probably null	Het
Kcnh6	A	G	11: 106,019,145	I499V	possibly damaging	Het
Kcnj10	T	A	1: 172,369,396	I159N	probably damaging	Het
Kcnmb4	T	A	10: 116,446,333	H153L	probably benign	Het
Klhl8	T	C	5: 103,870,538	N409S	probably benign	Het
Ksr1	A	G	11: 79,045,188	S117P	probably benign	Het
Lrfn3	A	T	7: 30,359,819	V327E	probably damaging	Het
Mrc2	C	A	11: 105,338,914	H724Q	probably benign	Het
Mtf2	T	A	5: 108,100,939	F372L	probably benign	Het
Nipbl	A	T	15: 8,291,513	D2703E	probably damaging	Het
Nova1	T	C	12: 46,817,017	Y50C	unknown	Het
Ofcc1	T	A	13: 40,142,801	Y519F	probably benign	Het
Olfr1180	A	C	2: 88,412,379	M93R	probably damaging	Het
Olfr1278	T	C	2: 111,293,003	I245T	probably damaging	Het
Olfr1314	A	T	2: 112,092,337	D121E	probably damaging	Het
Olfr170	T	A	16: 19,605,761	K301N	probably damaging	Het
Pclo	C	T	5: 14,669,311	A1154V	unknown	Het
Phrf1	A	G	7: 141,243,758	D4G	unknown	Het
Ppp4r3b	A	T	11: 29,173,306	M1L	probably damaging	Het
Prmt7	A	G	8: 106,217,242		probably null	Het
Retnlg	A	G	16: 48,873,675	T65A	possibly damaging	Het
Sbf2	T	C	7: 110,312,689	N1763D	probably benign	Het
Scn7a	A	G	2: 66,684,244	F1062S	possibly damaging	Het
Scube3	A	C	17: 28,164,053	K402Q	probably damaging	Het
Skiv2l	T	A	17: 34,840,190	D1067V	probably damaging	Het
Slc25a22	C	A	7: 141,433,958	D30Y	probably damaging	Het
Smim17	A	T	7: 6,424,721	Q2L	possibly damaging	Het
Son	G	T	16: 91,656,478	M704I	probably benign	Het
Son	C	T	16: 91,656,720	S785F	possibly damaging	Het
Tnks1bp1	T	C	2: 85,063,946	S1406P	probably benign	Het
Trim21	A	T	7: 102,563,701	V130E	probably benign	Het
Try5	T	A	6: 41,312,361	I94F	probably benign	Het
Tubb4a	C	T	17: 57,081,169	V286I	probably benign	Het
Vmn1r180	T	A	7: 23,952,651	S80T	probably benign	Het
Vmn2r114	A	C	17: 23,310,312	I272S	probably damaging	Het
Vmn2r12	A	T	5: 109,086,167	Y726*	probably null	Het
Zdhhc16	T	C	19: 41,938,026	F83L	probably damaging	Het
Zfp521	C	A	18: 13,846,080	L425F	probably damaging	Het

Other mutations in Tnfrsf21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01406:Tnfrsf21	APN	17	43037946	missense	probably damaging	1.00
IGL01663:Tnfrsf21	APN	17	43087811	missense	probably benign	0.13
IGL01811:Tnfrsf21	APN	17	43037613	missense	probably benign
IGL01916:Tnfrsf21	APN	17	43039803	missense	probably benign	0.00
IGL01934:Tnfrsf21	APN	17	43065187	missense	probably benign	0.15
IGL02184:Tnfrsf21	APN	17	43085463	missense	probably benign	0.37
IGL02292:Tnfrsf21	APN	17	43039911	missense	probably benign
IGL02385:Tnfrsf21	APN	17	43040051	missense	probably damaging	1.00
IGL02710:Tnfrsf21	APN	17	43087929	missense	probably damaging	0.97
IGL03001:Tnfrsf21	APN	17	43087895	missense	probably damaging	0.99
IGL03003:Tnfrsf21	APN	17	43039943	missense	probably damaging	1.00
PIT4480001:Tnfrsf21	UTSW	17	43037911	missense	probably benign	0.00
R0007:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0046:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0088:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0091:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0102:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0102:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0103:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0105:Tnfrsf21	UTSW	17	43040191	critical splice donor site	probably null
R0105:Tnfrsf21	UTSW	17	43040191	critical splice donor site	probably null
R0206:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0211:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0240:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0243:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0308:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0363:Tnfrsf21	UTSW	17	43037877	missense	probably benign	0.01
R0456:Tnfrsf21	UTSW	17	43038091	missense	probably benign	0.01
R0522:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0523:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0525:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0528:Tnfrsf21	UTSW	17	43037614	missense	probably benign
R0543:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0549:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0550:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0699:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0724:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0734:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0847:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0880:Tnfrsf21	UTSW	17	43037842	nonsense	probably null
R1591:Tnfrsf21	UTSW	17	43085374	missense	probably benign	0.01
R2069:Tnfrsf21	UTSW	17	43037938	missense	possibly damaging	0.67
R2153:Tnfrsf21	UTSW	17	43087872	missense	probably damaging	1.00
R2323:Tnfrsf21	UTSW	17	43085529	nonsense	probably null
R3941:Tnfrsf21	UTSW	17	43038010	missense	probably damaging	1.00
R4438:Tnfrsf21	UTSW	17	43087842	missense	possibly damaging	0.49
R4509:Tnfrsf21	UTSW	17	43085388	missense	probably benign	0.00
R4510:Tnfrsf21	UTSW	17	43065019	missense	probably damaging	0.98
R4511:Tnfrsf21	UTSW	17	43065019	missense	probably damaging	0.98
R4708:Tnfrsf21	UTSW	17	43038232	missense	possibly damaging	0.66
R4721:Tnfrsf21	UTSW	17	43085504	missense	probably damaging	1.00
R4811:Tnfrsf21	UTSW	17	43037730	missense	probably benign	0.00
R5437:Tnfrsf21	UTSW	17	43037862	missense	possibly damaging	0.55
R5767:Tnfrsf21	UTSW	17	43037659	missense	probably damaging	0.98
R6057:Tnfrsf21	UTSW	17	43039715	missense	possibly damaging	0.86
R6392:Tnfrsf21	UTSW	17	43017088	missense	probably benign	0.00
R6860:Tnfrsf21	UTSW	17	43017066	missense	probably benign
R7253:Tnfrsf21	UTSW	17	43037667	missense	probably benign	0.00
R7288:Tnfrsf21	UTSW	17	43037818	missense	possibly damaging	0.86
R7643:Tnfrsf21	UTSW	17	43037916	missense	probably benign	0.00
R7937:Tnfrsf21	UTSW	17	43037925	missense	probably benign	0.01
R8098:Tnfrsf21	UTSW	17	43039899	missense	probably benign
R8495:Tnfrsf21	UTSW	17	43038237	missense	probably benign
R8865:Tnfrsf21	UTSW	17	43085481	missense	probably damaging	1.00
R9088:Tnfrsf21	UTSW	17	43037716	missense	probably damaging	1.00
R9150:Tnfrsf21	UTSW	17	43087800	missense	probably damaging	1.00
R9220:Tnfrsf21	UTSW	17	43087910	missense	probably damaging	1.00
V3553:Tnfrsf21	UTSW	17	43037931	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CACACGAACTCTGAAAGGGTTC -3'
(R):5'- TCAGCTACAACTGGGCTGTG -3'

Sequencing Primer
(F):5'- CTCGCTTGAGCTTCATAGTAAGAC -3'
(R):5'- CTACAACTGGGCTGTGGGAGTG -3'

Posted On

2021-10-11