Mutagenetix > Incidental Mutation

Incidental Mutation 'R8992:Lct'

684447

Institutional Source

Beutler Lab

Gene Symbol

Lct

Ensembl Gene

ENSMUSG00000026354

Gene Name

lactase

Synonyms

LPH, LOC226413, Lphl

MMRRC Submission

Accession Numbers

Genbank: NM_001081078; MGI:104576

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8992 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

128284756-128328318 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 128300562 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 1065 (T1065S)

Ref Sequence

ENSEMBL: ENSMUSP00000073190 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073490]

AlphaFold

F8VPT3

Predicted Effect

probably damaging
Transcript: ENSMUST00000073490
AA Change: T1065S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000073190
Gene: ENSMUSG00000026354
AA Change: T1065S

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_1	76	226	1.6e-19	PFAM
low complexity region	322	340	N/A	INTRINSIC
Pfam:Glyco_hydro_1	380	849	4.8e-169	PFAM
low complexity region	865	875	N/A	INTRINSIC
Pfam:Glyco_hydro_1	902	1368	3.7e-181	PFAM
Pfam:Glyco_hydro_1	1377	1844	6.9e-183	PFAM
transmembrane domain	1885	1907	N/A	INTRINSIC

Meta Mutation Damage Score

0.4548

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyl hydrolase 1 family of proteins. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme is integral to the plasma membrane and has both phlorizin hydrolase activity and lactase activity. Mutations in this gene are associated with congenital lactase deficiency. Polymorphisms in this gene are associated with lactase persistence, in which intestinal lactase activity persists at childhood levels into adulthood. [provided by RefSeq, Jan 2016]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd14b	A	G	9: 106,451,618	D146G	probably benign	Het
Abhd6	T	A	14: 8,028,282	D4E	probably benign	Het
Atpif1	T	C	4: 132,533,374	D34G	probably benign	Het
Bcr	T	C	10: 75,131,572	F546S	probably damaging	Het
Bean1	CT	C	8: 104,182,032		probably null	Het
Ccdc141	A	T	2: 77,014,395	W1443R	probably damaging	Het
Chd7	A	G	4: 8,839,589	D1375G	probably damaging	Het
Chil1	A	T	1: 134,187,924	Q223H	probably benign	Het
Clcn2	A	T	16: 20,712,330	F260I	probably damaging	Het
Cpq	A	T	15: 33,594,235	D464V	probably benign	Het
Crygb	T	C	1: 65,082,141	D9G	probably damaging	Het
Cyp2b10	A	G	7: 25,925,390	K438E	unknown	Het
Cyp46a1	A	T	12: 108,358,107	D381V	possibly damaging	Het
Dhx40	A	C	11: 86,776,756		probably benign	Het
Dnase2b	G	T	3: 146,586,962	P152Q	probably damaging	Het
Duox1	A	T	2: 122,344,705	H1328L	probably damaging	Het
Ephb6	C	T	6: 41,613,359	A15V	probably benign	Het
Fam168b	A	G	1: 34,819,781	F102L	probably benign	Het
Fam3b	T	A	16: 97,476,394	D128V	probably damaging	Het
Galnt11	T	G	5: 25,264,985	H527Q	possibly damaging	Het
Gbp2b	A	T	3: 142,610,969	R460S	probably benign	Het
Gm7534	G	A	4: 134,202,667	T109I	probably damaging	Het
Hdhd2	A	C	18: 76,970,670	S246R	possibly damaging	Het
Heatr1	T	C	13: 12,401,114	M189T	probably damaging	Het
Ino80	A	G	2: 119,379,578	S1411P	possibly damaging	Het
Jakmip1	A	G	5: 37,117,538	T467A	probably benign	Het
Kcnh2	A	G	5: 24,331,870	S239P	probably benign	Het
Lrrc66	T	C	5: 73,629,884	D41G	probably benign	Het
Mfsd2b	A	T	12: 4,871,490	D26E	probably benign	Het
Myh1	A	T	11: 67,205,781	M333L	probably benign	Het
Neurl4	T	C	11: 69,908,132	V855A	possibly damaging	Het
Nfkb2	T	A	19: 46,306,865	V80D	probably damaging	Het
Nop9	T	C	14: 55,745,981	S70P	possibly damaging	Het
Olfr325	A	G	11: 58,580,912	S23G	probably benign	Het
Pcdhb14	G	T	18: 37,449,178	D446Y	probably damaging	Het
Pclo	C	T	5: 14,669,311	A1154V	unknown	Het
Pdgfa	G	T	5: 138,986,222	Q141K	probably damaging	Het
Plekhh1	G	T	12: 79,075,533	L1133F	probably damaging	Het
Pole	A	T	5: 110,323,622	N1411Y	possibly damaging	Het
Primpol	A	G	8: 46,581,562		probably benign	Het
Psmc5	T	G	11: 106,261,961	V203G	probably damaging	Het
Ptgdr	C	T	14: 44,858,724	C177Y	probably damaging	Het
Ptgir	A	T	7: 16,907,295	I171F	probably damaging	Het
Ptprg	T	A	14: 12,154,170	H630Q	probably benign	Het
Ptrh2	A	G	11: 86,690,081	T175A	possibly damaging	Het
Ralgapb	A	G	2: 158,454,277	T857A	probably damaging	Het
Rnf24	A	G	2: 131,313,277	F10S	possibly damaging	Het
Rreb1	C	A	13: 37,930,376	S570R	probably benign	Het
Rttn	A	G	18: 88,977,708	N205S	probably benign	Het
Rusc1	T	C	3: 89,092,058	E139G	probably benign	Het
Scn2a	A	G	2: 65,763,898	N1697S	probably damaging	Het
Serpinb3a	T	A	1: 107,047,177	M209L	probably damaging	Het
Shank3	A	G	15: 89,548,685	D1211G	possibly damaging	Het
Slc22a12	C	A	19: 6,542,484	R90L	possibly damaging	Het
Slc6a13	G	A	6: 121,336,942	W548*	probably null	Het
Srfbp1	T	A	18: 52,476,320	L59*	probably null	Het
Ss18	A	T	18: 14,670,323	S73T	probably damaging	Het
Syne1	T	C	10: 5,185,508	K189R	probably benign	Het
Szt2	G	T	4: 118,382,788		probably benign	Het
Tbx1	T	A	16: 18,584,187	H183L	probably damaging	Het
Thop1	A	G	10: 81,080,138	E385G	possibly damaging	Het
Tmem168	C	A	6: 13,602,850	M172I	possibly damaging	Het
Tmem67	A	G	4: 12,058,559	Y513H	probably damaging	Het
Top1	A	G	2: 160,721,001	D709G	probably damaging	Het
Tprgl	A	C	4: 154,158,433	S247A	probably damaging	Het
Trim46	A	G	3: 89,236,385	S602P	probably damaging	Het
Ttc30a1	A	T	2: 75,979,907	C611S	probably benign	Het
Ttc7b	T	C	12: 100,500,174	K60E	probably benign	Het
Ttn	G	A	2: 76,884,471	S8053F	unknown	Het
Tyw1	G	A	5: 130,269,224	R202Q	probably damaging	Het
Usp24	T	A	4: 106,377,565	H956Q	probably benign	Het
Vcp	T	C	4: 42,980,828	T761A	probably benign	Het
Xpc	G	A	6: 91,500,974	T309I	possibly damaging	Het
Zfp560	C	T	9: 20,349,599	M129I	probably benign	Het

Other mutations in Lct

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00777:Lct	APN	1	128287556	missense	probably benign	0.09
IGL00970:Lct	APN	1	128304068	missense	probably damaging	1.00
IGL01022:Lct	APN	1	128300859	missense	probably benign
IGL01878:Lct	APN	1	128294266	missense	probably damaging	1.00
IGL01892:Lct	APN	1	128307605	missense	probably damaging	1.00
IGL02307:Lct	APN	1	128286590	missense	possibly damaging	0.70
IGL02434:Lct	APN	1	128303790	missense	probably damaging	0.97
IGL02559:Lct	APN	1	128294266	missense	probably damaging	1.00
IGL02623:Lct	APN	1	128308251	missense	probably benign	0.01
IGL02818:Lct	APN	1	128300168	missense	probably damaging	1.00
IGL02949:Lct	APN	1	128313132	missense	probably benign	0.26
IGL02951:Lct	APN	1	128300211	missense	probably damaging	1.00
IGL03087:Lct	APN	1	128300375	missense	possibly damaging	0.81
IGL03227:Lct	APN	1	128327689	missense	probably benign	0.09
ANU18:Lct	UTSW	1	128308047	nonsense	probably null
R0071:Lct	UTSW	1	128292018	nonsense	probably null
R0071:Lct	UTSW	1	128292018	nonsense	probably null
R0135:Lct	UTSW	1	128285123	missense	probably damaging	0.98
R0145:Lct	UTSW	1	128327895	missense	probably benign	0.00
R0179:Lct	UTSW	1	128327685	missense	probably benign
R0331:Lct	UTSW	1	128298742	splice site	probably benign
R0366:Lct	UTSW	1	128286462	missense	probably benign	0.03
R0399:Lct	UTSW	1	128300525	missense	probably damaging	1.00
R0492:Lct	UTSW	1	128300582	missense	probably damaging	1.00
R0548:Lct	UTSW	1	128285195	missense	probably damaging	1.00
R0691:Lct	UTSW	1	128308234	missense	probably benign	0.00
R0755:Lct	UTSW	1	128294135	missense	possibly damaging	0.46
R0839:Lct	UTSW	1	128286609	missense	probably benign	0.00
R1128:Lct	UTSW	1	128301309	missense	probably damaging	0.99
R1135:Lct	UTSW	1	128294124	critical splice donor site	probably null
R1321:Lct	UTSW	1	128300022	missense	probably benign
R1448:Lct	UTSW	1	128307822	missense	probably damaging	0.99
R1450:Lct	UTSW	1	128307903	missense	probably damaging	1.00
R1572:Lct	UTSW	1	128294195	missense	probably benign	0.25
R1582:Lct	UTSW	1	128300562	missense	probably damaging	1.00
R1668:Lct	UTSW	1	128287722	splice site	probably null
R1757:Lct	UTSW	1	128301257	missense	probably damaging	1.00
R1775:Lct	UTSW	1	128300301	missense	probably damaging	1.00
R1792:Lct	UTSW	1	128327942	missense	possibly damaging	0.54
R1815:Lct	UTSW	1	128300159	missense	probably damaging	1.00
R1932:Lct	UTSW	1	128294161	missense	probably damaging	1.00
R2325:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R2381:Lct	UTSW	1	128304121	nonsense	probably null
R3001:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3002:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3003:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3011:Lct	UTSW	1	128301372	missense	possibly damaging	0.74
R3082:Lct	UTSW	1	128287608	missense	probably damaging	1.00
R3683:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3684:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3726:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3886:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3887:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3888:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4019:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4027:Lct	UTSW	1	128285181	missense	probably benign	0.00
R4226:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4409:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4514:Lct	UTSW	1	128300514	missense	probably benign
R4570:Lct	UTSW	1	128299904	missense	probably benign	0.01
R4776:Lct	UTSW	1	128300387	missense	probably damaging	0.99
R5001:Lct	UTSW	1	128308241	missense	probably damaging	0.96
R5021:Lct	UTSW	1	128300565	missense	probably benign	0.38
R5318:Lct	UTSW	1	128304372	missense	probably damaging	1.00
R5330:Lct	UTSW	1	128298529	missense	probably benign	0.06
R5385:Lct	UTSW	1	128311617	missense	possibly damaging	0.63
R5499:Lct	UTSW	1	128286677	missense	probably damaging	1.00
R5508:Lct	UTSW	1	128294131	missense	probably damaging	1.00
R5642:Lct	UTSW	1	128295232	missense	probably damaging	1.00
R5724:Lct	UTSW	1	128300336	missense	probably benign
R6026:Lct	UTSW	1	128300018	missense	probably benign
R6044:Lct	UTSW	1	128307980	missense	possibly damaging	0.95
R6175:Lct	UTSW	1	128327714	missense	probably damaging	1.00
R6277:Lct	UTSW	1	128304237	missense	probably benign	0.01
R6412:Lct	UTSW	1	128327718	missense	probably benign	0.00
R6480:Lct	UTSW	1	128294320	missense	probably damaging	1.00
R6526:Lct	UTSW	1	128300478	missense	probably benign	0.05
R6620:Lct	UTSW	1	128295072	critical splice donor site	probably null
R7214:Lct	UTSW	1	128300460	missense	probably benign	0.00
R7308:Lct	UTSW	1	128319087	missense	probably benign	0.00
R7577:Lct	UTSW	1	128300732	missense	probably damaging	0.99
R7626:Lct	UTSW	1	128285195	missense	probably damaging	1.00
R7737:Lct	UTSW	1	128298693	missense	probably benign	0.12
R7901:Lct	UTSW	1	128288985	missense	probably benign	0.44
R8033:Lct	UTSW	1	128285259	missense	probably benign	0.03
R8373:Lct	UTSW	1	128303840	missense	probably damaging	1.00
R8504:Lct	UTSW	1	128287569	missense	probably damaging	1.00
R8751:Lct	UTSW	1	128293797	missense	probably benign	0.18
R8781:Lct	UTSW	1	128287524	missense	probably damaging	1.00
R8797:Lct	UTSW	1	128303947	missense	possibly damaging	0.77
R8926:Lct	UTSW	1	128300411	missense	probably damaging	1.00
R8949:Lct	UTSW	1	128294192	missense	probably damaging	1.00
R9138:Lct	UTSW	1	128300157	missense	probably benign	0.03
R9260:Lct	UTSW	1	128299967	nonsense	probably null
R9416:Lct	UTSW	1	128300592	missense	possibly damaging	0.74
R9531:Lct	UTSW	1	128307861	missense	probably benign	0.00
X0052:Lct	UTSW	1	128307630	missense	probably damaging	1.00
YA93:Lct	UTSW	1	128301320	missense	probably damaging	1.00
Z1176:Lct	UTSW	1	128287611	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CAGTGAGTGTTGAGGCTCAGAG -3'
(R):5'- ACGGGAAGAAACAGTTCCATC -3'

Sequencing Primer
(F):5'- TCAGAGAGATGACCCCCTTCTG -3'
(R):5'- CAAACTGATTGACAGATTGTTGGAG -3'

Posted On

2021-10-11