Mutagenetix > Incidental Mutation

Incidental Mutation 'R8992:Duox1'

684454

Institutional Source

Beutler Lab

Gene Symbol

Duox1

Ensembl Gene

ENSMUSG00000033268

Gene Name

dual oxidase 1

Synonyms

THOX1, LNOX1, 9930101G15Rik, NOXEF1

MMRRC Submission

Accession Numbers

Genbank: NM_001099297; MGI: 2139422

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8992 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

122315672-122347972 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 122344705 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 1328 (H1328L)

Ref Sequence

ENSEMBL: ENSMUSP00000097060 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048635] [ENSMUST00000099461] [ENSMUST00000110530] [ENSMUST00000110531] [ENSMUST00000110532] [ENSMUST00000121237] [ENSMUST00000125826] [ENSMUST00000139819]

AlphaFold

A2AQ92

Predicted Effect

probably benign
Transcript: ENSMUST00000048635

SMART Domains

Protein: ENSMUSP00000045135
Gene: ENSMUSG00000033256

Domain	Start	End	E-Value	Type
low complexity region	48	67	N/A	INTRINSIC
SH2	136	220	9.16e-27	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000099461
AA Change: H1328L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000097060
Gene: ENSMUSG00000033268
AA Change: H1328L

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:An_peroxidase	29	557	2.1e-134	PFAM
transmembrane domain	594	616	N/A	INTRINSIC
EFh	819	847	1.82e-4	SMART
EFh	855	883	3.45e-5	SMART
transmembrane domain	1044	1066	N/A	INTRINSIC
Pfam:Ferric_reduct	1087	1236	5.3e-21	PFAM
Pfam:FAD_binding_8	1272	1374	8.5e-21	PFAM
Pfam:NAD_binding_6	1380	1534	3.5e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110530

SMART Domains

Protein: ENSMUSP00000106159
Gene: ENSMUSG00000033256

Domain	Start	End	E-Value	Type
low complexity region	42	61	N/A	INTRINSIC
SH2	130	214	9.16e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110531

SMART Domains

Protein: ENSMUSP00000106160
Gene: ENSMUSG00000033256

Domain	Start	End	E-Value	Type
low complexity region	48	67	N/A	INTRINSIC
SH2	136	220	9.16e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110532

SMART Domains

Protein: ENSMUSP00000106161
Gene: ENSMUSG00000033256

Domain	Start	End	E-Value	Type
low complexity region	19	38	N/A	INTRINSIC
low complexity region	45	61	N/A	INTRINSIC
low complexity region	77	87	N/A	INTRINSIC
low complexity region	146	165	N/A	INTRINSIC
Blast:SH2	225	278	2e-22	BLAST
SCOP:d1ayaa_	237	291	1e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000121237

SMART Domains

Protein: ENSMUSP00000113923
Gene: ENSMUSG00000033256

Domain	Start	End	E-Value	Type
low complexity region	42	61	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000125826

SMART Domains

Protein: ENSMUSP00000117099
Gene: ENSMUSG00000033256

Domain	Start	End	E-Value	Type
low complexity region	14	56	N/A	INTRINSIC
low complexity region	76	105	N/A	INTRINSIC
low complexity region	129	148	N/A	INTRINSIC
low complexity region	155	171	N/A	INTRINSIC
low complexity region	187	197	N/A	INTRINSIC
low complexity region	256	275	N/A	INTRINSIC
SH2	344	428	9.16e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000139819

SMART Domains

Protein: ENSMUSP00000119980
Gene: ENSMUSG00000033256

Domain	Start	End	E-Value	Type
low complexity region	14	24	N/A	INTRINSIC
low complexity region	83	102	N/A	INTRINSIC
low complexity region	149	163	N/A	INTRINSIC
SH2	218	302	9.16e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000143484

SMART Domains

Protein: ENSMUSP00000120732
Gene: ENSMUSG00000033256

Domain	Start	End	E-Value	Type
low complexity region	14	33	N/A	INTRINSIC
SH2	71	155	3.19e-26	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000151130

SMART Domains

Protein: ENSMUSP00000114524
Gene: ENSMUSG00000033256

Domain	Start	End	E-Value	Type
low complexity region	6	48	N/A	INTRINSIC
low complexity region	68	97	N/A	INTRINSIC
low complexity region	121	140	N/A	INTRINSIC
low complexity region	147	163	N/A	INTRINSIC
low complexity region	179	189	N/A	INTRINSIC
low complexity region	248	267	N/A	INTRINSIC

Meta Mutation Damage Score

0.6505

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes proteins encoded by this gene and the similar DUOX2 gene. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. This protein generates hydrogen peroxide and thereby plays a role in the activity of thyroid peroxidase, lactoperoxidase, and in lactoperoxidase-mediated antimicrobial defense at mucosal surfaces. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2012]

Allele List at MGI

All alleles(6) : Targeted, other(3) Gene trapped(3)

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd14b	A	G	9: 106,451,618	D146G	probably benign	Het
Abhd6	T	A	14: 8,028,282	D4E	probably benign	Het
Atpif1	T	C	4: 132,533,374	D34G	probably benign	Het
Bcr	T	C	10: 75,131,572	F546S	probably damaging	Het
Bean1	CT	C	8: 104,182,032		probably null	Het
Ccdc141	A	T	2: 77,014,395	W1443R	probably damaging	Het
Chd7	A	G	4: 8,839,589	D1375G	probably damaging	Het
Chil1	A	T	1: 134,187,924	Q223H	probably benign	Het
Clcn2	A	T	16: 20,712,330	F260I	probably damaging	Het
Cpq	A	T	15: 33,594,235	D464V	probably benign	Het
Crygb	T	C	1: 65,082,141	D9G	probably damaging	Het
Cyp2b10	A	G	7: 25,925,390	K438E	unknown	Het
Cyp46a1	A	T	12: 108,358,107	D381V	possibly damaging	Het
Dhx40	A	C	11: 86,776,756		probably benign	Het
Dnase2b	G	T	3: 146,586,962	P152Q	probably damaging	Het
Ephb6	C	T	6: 41,613,359	A15V	probably benign	Het
Fam168b	A	G	1: 34,819,781	F102L	probably benign	Het
Fam3b	T	A	16: 97,476,394	D128V	probably damaging	Het
Galnt11	T	G	5: 25,264,985	H527Q	possibly damaging	Het
Gbp2b	A	T	3: 142,610,969	R460S	probably benign	Het
Gm7534	G	A	4: 134,202,667	T109I	probably damaging	Het
Hdhd2	A	C	18: 76,970,670	S246R	possibly damaging	Het
Heatr1	T	C	13: 12,401,114	M189T	probably damaging	Het
Ino80	A	G	2: 119,379,578	S1411P	possibly damaging	Het
Jakmip1	A	G	5: 37,117,538	T467A	probably benign	Het
Kcnh2	A	G	5: 24,331,870	S239P	probably benign	Het
Lct	T	A	1: 128,300,562	T1065S	probably damaging	Het
Lrrc66	T	C	5: 73,629,884	D41G	probably benign	Het
Mfsd2b	A	T	12: 4,871,490	D26E	probably benign	Het
Myh1	A	T	11: 67,205,781	M333L	probably benign	Het
Neurl4	T	C	11: 69,908,132	V855A	possibly damaging	Het
Nfkb2	T	A	19: 46,306,865	V80D	probably damaging	Het
Nop9	T	C	14: 55,745,981	S70P	possibly damaging	Het
Olfr325	A	G	11: 58,580,912	S23G	probably benign	Het
Pcdhb14	G	T	18: 37,449,178	D446Y	probably damaging	Het
Pclo	C	T	5: 14,669,311	A1154V	unknown	Het
Pdgfa	G	T	5: 138,986,222	Q141K	probably damaging	Het
Plekhh1	G	T	12: 79,075,533	L1133F	probably damaging	Het
Pole	A	T	5: 110,323,622	N1411Y	possibly damaging	Het
Primpol	A	G	8: 46,581,562		probably benign	Het
Psmc5	T	G	11: 106,261,961	V203G	probably damaging	Het
Ptgdr	C	T	14: 44,858,724	C177Y	probably damaging	Het
Ptgir	A	T	7: 16,907,295	I171F	probably damaging	Het
Ptprg	T	A	14: 12,154,170	H630Q	probably benign	Het
Ptrh2	A	G	11: 86,690,081	T175A	possibly damaging	Het
Ralgapb	A	G	2: 158,454,277	T857A	probably damaging	Het
Rnf24	A	G	2: 131,313,277	F10S	possibly damaging	Het
Rreb1	C	A	13: 37,930,376	S570R	probably benign	Het
Rttn	A	G	18: 88,977,708	N205S	probably benign	Het
Rusc1	T	C	3: 89,092,058	E139G	probably benign	Het
Scn2a	A	G	2: 65,763,898	N1697S	probably damaging	Het
Serpinb3a	T	A	1: 107,047,177	M209L	probably damaging	Het
Shank3	A	G	15: 89,548,685	D1211G	possibly damaging	Het
Slc22a12	C	A	19: 6,542,484	R90L	possibly damaging	Het
Slc6a13	G	A	6: 121,336,942	W548*	probably null	Het
Srfbp1	T	A	18: 52,476,320	L59*	probably null	Het
Ss18	A	T	18: 14,670,323	S73T	probably damaging	Het
Syne1	T	C	10: 5,185,508	K189R	probably benign	Het
Szt2	G	T	4: 118,382,788		probably benign	Het
Tbx1	T	A	16: 18,584,187	H183L	probably damaging	Het
Thop1	A	G	10: 81,080,138	E385G	possibly damaging	Het
Tmem168	C	A	6: 13,602,850	M172I	possibly damaging	Het
Tmem67	A	G	4: 12,058,559	Y513H	probably damaging	Het
Top1	A	G	2: 160,721,001	D709G	probably damaging	Het
Tprgl	A	C	4: 154,158,433	S247A	probably damaging	Het
Trim46	A	G	3: 89,236,385	S602P	probably damaging	Het
Ttc30a1	A	T	2: 75,979,907	C611S	probably benign	Het
Ttc7b	T	C	12: 100,500,174	K60E	probably benign	Het
Ttn	G	A	2: 76,884,471	S8053F	unknown	Het
Tyw1	G	A	5: 130,269,224	R202Q	probably damaging	Het
Usp24	T	A	4: 106,377,565	H956Q	probably benign	Het
Vcp	T	C	4: 42,980,828	T761A	probably benign	Het
Xpc	G	A	6: 91,500,974	T309I	possibly damaging	Het
Zfp560	C	T	9: 20,349,599	M129I	probably benign	Het

Other mutations in Duox1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00650:Duox1	APN	2	122333141	missense	possibly damaging	0.55
IGL00956:Duox1	APN	2	122323306	missense	probably benign	0.42
IGL01413:Duox1	APN	2	122320710	missense	probably benign	0.03
IGL01444:Duox1	APN	2	122340090	missense	probably damaging	0.98
IGL01633:Duox1	APN	2	122333798	missense	probably benign	0.00
IGL01814:Duox1	APN	2	122346272	missense	probably damaging	0.99
IGL01868:Duox1	APN	2	122338407	missense	probably benign
IGL02096:Duox1	APN	2	122344174	missense	probably damaging	0.99
IGL02126:Duox1	APN	2	122346336	missense	probably benign	0.21
IGL02342:Duox1	APN	2	122347312	missense	probably damaging	1.00
IGL02687:Duox1	APN	2	122336415	missense	probably damaging	1.00
IGL02708:Duox1	APN	2	122326017	missense	possibly damaging	0.81
IGL02935:Duox1	APN	2	122324519	missense	possibly damaging	0.56
antiquity	UTSW	2	122340201	missense	probably damaging	1.00
Dejavous	UTSW	2	122320864	missense	probably damaging	1.00
R1706_Duox1_051	UTSW	2	122319472	missense	probably benign	0.01
R5032_duox1_732	UTSW	2	122337317	missense	probably benign
Vaguely	UTSW	2	122326135	nonsense	probably null
D4043:Duox1	UTSW	2	122344795	missense	probably benign
R0047:Duox1	UTSW	2	122346641	unclassified	probably benign
R0047:Duox1	UTSW	2	122346641	unclassified	probably benign
R0241:Duox1	UTSW	2	122333397	splice site	probably benign
R0479:Duox1	UTSW	2	122346380	missense	probably damaging	1.00
R0834:Duox1	UTSW	2	122346501	missense	probably damaging	1.00
R1105:Duox1	UTSW	2	122337702	missense	probably damaging	0.97
R1205:Duox1	UTSW	2	122327925	nonsense	probably null
R1281:Duox1	UTSW	2	122327088	missense	probably damaging	1.00
R1302:Duox1	UTSW	2	122347279	missense	probably benign	0.24
R1532:Duox1	UTSW	2	122344723	missense	probably damaging	1.00
R1706:Duox1	UTSW	2	122319472	missense	probably benign	0.01
R1719:Duox1	UTSW	2	122338644	missense	possibly damaging	0.93
R1753:Duox1	UTSW	2	122333429	missense	probably damaging	1.00
R1827:Duox1	UTSW	2	122347380	nonsense	probably null
R1828:Duox1	UTSW	2	122347380	nonsense	probably null
R1940:Duox1	UTSW	2	122325984	missense	probably benign	0.06
R1944:Duox1	UTSW	2	122346520	missense	probably damaging	0.99
R2069:Duox1	UTSW	2	122333062	missense	probably benign
R2113:Duox1	UTSW	2	122337254	missense	probably benign
R2202:Duox1	UTSW	2	122344713	missense	probably benign	0.19
R2314:Duox1	UTSW	2	122333730	nonsense	probably null
R2507:Duox1	UTSW	2	122333138	missense	probably benign	0.34
R2508:Duox1	UTSW	2	122333138	missense	probably benign	0.34
R3177:Duox1	UTSW	2	122340116	missense	probably damaging	1.00
R3277:Duox1	UTSW	2	122340116	missense	probably damaging	1.00
R4124:Duox1	UTSW	2	122337421	missense	probably damaging	1.00
R4271:Duox1	UTSW	2	122324375	missense	probably damaging	0.96
R4411:Duox1	UTSW	2	122337634	missense	probably benign	0.30
R4419:Duox1	UTSW	2	122327126	missense	probably benign
R4420:Duox1	UTSW	2	122327126	missense	probably benign
R4578:Duox1	UTSW	2	122333777	missense	probably benign	0.15
R4628:Duox1	UTSW	2	122346252	missense	probably damaging	1.00
R4665:Duox1	UTSW	2	122319475	missense	probably benign	0.00
R4666:Duox1	UTSW	2	122319475	missense	probably benign	0.00
R4730:Duox1	UTSW	2	122333831	missense	probably damaging	1.00
R4767:Duox1	UTSW	2	122333441	missense	possibly damaging	0.79
R4857:Duox1	UTSW	2	122315731	missense	probably benign	0.05
R4904:Duox1	UTSW	2	122320864	missense	probably damaging	1.00
R5032:Duox1	UTSW	2	122337317	missense	probably benign
R5201:Duox1	UTSW	2	122327922	missense	probably benign
R5474:Duox1	UTSW	2	122346625	missense	probably benign	0.02
R5835:Duox1	UTSW	2	122327860	missense	probably benign	0.00
R5939:Duox1	UTSW	2	122346351	missense	probably damaging	1.00
R5941:Duox1	UTSW	2	122344156	missense	probably damaging	0.97
R5943:Duox1	UTSW	2	122333435	missense	probably benign	0.00
R5970:Duox1	UTSW	2	122340201	missense	probably damaging	1.00
R6023:Duox1	UTSW	2	122337684	missense	probably benign	0.19
R6050:Duox1	UTSW	2	122319475	missense	probably benign	0.00
R6064:Duox1	UTSW	2	122320762	missense	probably benign	0.00
R6093:Duox1	UTSW	2	122347274	missense	probably benign	0.01
R6188:Duox1	UTSW	2	122319794	missense	probably benign	0.00
R6246:Duox1	UTSW	2	122327174	missense	probably damaging	1.00
R6259:Duox1	UTSW	2	122344783	missense	probably benign	0.00
R6290:Duox1	UTSW	2	122333807	missense	possibly damaging	0.92
R6300:Duox1	UTSW	2	122337700	missense	probably damaging	0.99
R6341:Duox1	UTSW	2	122337721	missense	probably damaging	0.98
R6498:Duox1	UTSW	2	122319607	missense	probably damaging	1.00
R6883:Duox1	UTSW	2	122324584	splice site	probably null
R7002:Duox1	UTSW	2	122319877	nonsense	probably null
R7410:Duox1	UTSW	2	122346393	missense	probably damaging	1.00
R7421:Duox1	UTSW	2	122323230	missense	probably damaging	1.00
R7608:Duox1	UTSW	2	122326135	nonsense	probably null
R7702:Duox1	UTSW	2	122329639	missense	possibly damaging	0.86
R7766:Duox1	UTSW	2	122337301	missense	probably benign
R7833:Duox1	UTSW	2	122324388	missense	probably damaging	1.00
R7980:Duox1	UTSW	2	122347320	missense	possibly damaging	0.71
R8275:Duox1	UTSW	2	122344768	missense	probably benign	0.02
R8717:Duox1	UTSW	2	122337671	missense	possibly damaging	0.88
R9196:Duox1	UTSW	2	122320208	missense	probably benign	0.08
R9344:Duox1	UTSW	2	122337682	missense	probably benign	0.14
R9397:Duox1	UTSW	2	122320302	missense	possibly damaging	0.48
R9491:Duox1	UTSW	2	122326426	missense	probably benign	0.01
R9510:Duox1	UTSW	2	122329542	missense	possibly damaging	0.92
R9521:Duox1	UTSW	2	122328735	missense	possibly damaging	0.81
R9562:Duox1	UTSW	2	122320722	missense	probably damaging	1.00
R9565:Duox1	UTSW	2	122320722	missense	probably damaging	1.00
R9569:Duox1	UTSW	2	122318490	missense	probably benign
Z1176:Duox1	UTSW	2	122333038	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCTGAGGTTGGAGGAACTTC -3'
(R):5'- CAAGTCTCTGGATTGTGGAAGAG -3'

Sequencing Primer
(F):5'- GAACTTCTGGAGACCATACTGTTGC -3'
(R):5'- CTCTGGATTGTGGAAGAGGGTAC -3'

Posted On

2021-10-11