Incidental Mutation 'R8992:Gbp2b'
ID 684460
Institutional Source Beutler Lab
Gene Symbol Gbp2b
Ensembl Gene ENSMUSG00000040264
Gene Name guanylate binding protein 2b
Synonyms Mag-1, Mpa-1, Mpa1, Gbp-1, Gbp1
MMRRC Submission 068823-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8992 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 142300608-142324940 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 142316730 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 460 (R460S)
Ref Sequence ENSEMBL: ENSMUSP00000029936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029936]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000029936
AA Change: R460S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000029936
Gene: ENSMUSG00000040264
AA Change: R460S

DomainStartEndE-ValueType
Pfam:GBP 18 280 4.1e-122 PFAM
Pfam:GBP_C 282 578 5.5e-125 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanylate-binding protein (GBP) family. GBPs specifically bind guanine nucleotides (GMP, GDP, and GTP) and contain two of the three consensus motifs found in typical GTP-binding proteins. The encoded protein interacts with a member of the germinal center kinase family. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd14b A G 9: 106,328,817 (GRCm39) D146G probably benign Het
Abhd6 T A 14: 8,028,282 (GRCm38) D4E probably benign Het
Atp5if1 T C 4: 132,260,685 (GRCm39) D34G probably benign Het
Bcr T C 10: 74,967,404 (GRCm39) F546S probably damaging Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Ccdc141 A T 2: 76,844,739 (GRCm39) W1443R probably damaging Het
Chd7 A G 4: 8,839,589 (GRCm39) D1375G probably damaging Het
Chi3l1 A T 1: 134,115,662 (GRCm39) Q223H probably benign Het
Clcn2 A T 16: 20,531,080 (GRCm39) F260I probably damaging Het
Cpq A T 15: 33,594,381 (GRCm39) D464V probably benign Het
Crygb T C 1: 65,121,300 (GRCm39) D9G probably damaging Het
Cyp2b10 A G 7: 25,624,815 (GRCm39) K438E unknown Het
Cyp46a1 A T 12: 108,324,366 (GRCm39) D381V possibly damaging Het
Dhx40 A C 11: 86,667,582 (GRCm39) probably benign Het
Dnase2b G T 3: 146,292,717 (GRCm39) P152Q probably damaging Het
Duox1 A T 2: 122,175,186 (GRCm39) H1328L probably damaging Het
Ephb6 C T 6: 41,590,293 (GRCm39) A15V probably benign Het
Fam168b A G 1: 34,858,862 (GRCm39) F102L probably benign Het
Fam3b T A 16: 97,277,594 (GRCm39) D128V probably damaging Het
Galnt11 T G 5: 25,469,983 (GRCm39) H527Q possibly damaging Het
Hdhd2 A C 18: 77,058,366 (GRCm39) S246R possibly damaging Het
Heatr1 T C 13: 12,415,995 (GRCm39) M189T probably damaging Het
Ift70a1 A T 2: 75,810,251 (GRCm39) C611S probably benign Het
Ino80 A G 2: 119,210,059 (GRCm39) S1411P possibly damaging Het
Jakmip1 A G 5: 37,274,882 (GRCm39) T467A probably benign Het
Kcnh2 A G 5: 24,536,868 (GRCm39) S239P probably benign Het
Lct T A 1: 128,228,299 (GRCm39) T1065S probably damaging Het
Lrrc66 T C 5: 73,787,227 (GRCm39) D41G probably benign Het
Mfsd2b A T 12: 4,921,490 (GRCm39) D26E probably benign Het
Myh1 A T 11: 67,096,607 (GRCm39) M333L probably benign Het
Neurl4 T C 11: 69,798,958 (GRCm39) V855A possibly damaging Het
Nfkb2 T A 19: 46,295,304 (GRCm39) V80D probably damaging Het
Nop9 T C 14: 55,983,438 (GRCm39) S70P possibly damaging Het
Or2t46 A G 11: 58,471,738 (GRCm39) S23G probably benign Het
Pcdhb14 G T 18: 37,582,231 (GRCm39) D446Y probably damaging Het
Pclo C T 5: 14,719,325 (GRCm39) A1154V unknown Het
Pdgfa G T 5: 138,971,977 (GRCm39) Q141K probably damaging Het
Plekhh1 G T 12: 79,122,307 (GRCm39) L1133F probably damaging Het
Pole A T 5: 110,471,488 (GRCm39) N1411Y possibly damaging Het
Primpol A G 8: 47,034,597 (GRCm39) probably benign Het
Psmc5 T G 11: 106,152,787 (GRCm39) V203G probably damaging Het
Ptgdr C T 14: 45,096,181 (GRCm39) C177Y probably damaging Het
Ptgir A T 7: 16,641,220 (GRCm39) I171F probably damaging Het
Ptprg T A 14: 12,154,170 (GRCm38) H630Q probably benign Het
Ptrh2 A G 11: 86,580,907 (GRCm39) T175A possibly damaging Het
Ralgapb A G 2: 158,296,197 (GRCm39) T857A probably damaging Het
Rnf24 A G 2: 131,155,197 (GRCm39) F10S possibly damaging Het
Rreb1 C A 13: 38,114,352 (GRCm39) S570R probably benign Het
Rttn A G 18: 88,995,832 (GRCm39) N205S probably benign Het
Rusc1 T C 3: 88,999,365 (GRCm39) E139G probably benign Het
Scn2a A G 2: 65,594,242 (GRCm39) N1697S probably damaging Het
Serpinb3a T A 1: 106,974,907 (GRCm39) M209L probably damaging Het
Shank3 A G 15: 89,432,888 (GRCm39) D1211G possibly damaging Het
Slc22a12 C A 19: 6,592,514 (GRCm39) R90L possibly damaging Het
Slc6a13 G A 6: 121,313,901 (GRCm39) W548* probably null Het
Srfbp1 T A 18: 52,609,392 (GRCm39) L59* probably null Het
Ss18 A T 18: 14,803,380 (GRCm39) S73T probably damaging Het
Syne1 T C 10: 5,135,508 (GRCm39) K189R probably benign Het
Szt2 G T 4: 118,239,985 (GRCm39) probably benign Het
Tbx1 T A 16: 18,402,937 (GRCm39) H183L probably damaging Het
Thop1 A G 10: 80,915,972 (GRCm39) E385G possibly damaging Het
Tmem168 C A 6: 13,602,849 (GRCm39) M172I possibly damaging Het
Tmem67 A G 4: 12,058,559 (GRCm39) Y513H probably damaging Het
Top1 A G 2: 160,562,921 (GRCm39) D709G probably damaging Het
Tprg1l A C 4: 154,242,890 (GRCm39) S247A probably damaging Het
Trim46 A G 3: 89,143,692 (GRCm39) S602P probably damaging Het
Ttc7b T C 12: 100,466,433 (GRCm39) K60E probably benign Het
Ttn G A 2: 76,714,815 (GRCm39) S8053F unknown Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Usp24 T A 4: 106,234,762 (GRCm39) H956Q probably benign Het
Vcp T C 4: 42,980,828 (GRCm39) T761A probably benign Het
Xpc G A 6: 91,477,956 (GRCm39) T309I possibly damaging Het
Zfp560 C T 9: 20,260,895 (GRCm39) M129I probably benign Het
Zpld2 G A 4: 133,929,978 (GRCm39) T109I probably damaging Het
Other mutations in Gbp2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Gbp2b APN 3 142,304,073 (GRCm39) missense probably damaging 1.00
IGL01892:Gbp2b APN 3 142,309,381 (GRCm39) missense probably benign 0.03
IGL01989:Gbp2b APN 3 142,317,201 (GRCm39) missense probably benign 0.19
IGL02019:Gbp2b APN 3 142,312,751 (GRCm39) missense possibly damaging 0.52
IGL02338:Gbp2b APN 3 142,309,987 (GRCm39) missense probably benign 0.09
IGL02657:Gbp2b APN 3 142,309,873 (GRCm39) missense probably damaging 1.00
IGL03148:Gbp2b APN 3 142,312,642 (GRCm39) missense probably benign 0.00
FR4304:Gbp2b UTSW 3 142,309,413 (GRCm39) missense probably benign 0.00
FR4340:Gbp2b UTSW 3 142,309,413 (GRCm39) missense probably benign 0.00
FR4342:Gbp2b UTSW 3 142,309,413 (GRCm39) missense probably benign 0.00
FR4589:Gbp2b UTSW 3 142,309,413 (GRCm39) missense probably benign 0.00
R0329:Gbp2b UTSW 3 142,313,937 (GRCm39) missense probably benign 0.01
R0345:Gbp2b UTSW 3 142,313,944 (GRCm39) missense probably damaging 1.00
R0358:Gbp2b UTSW 3 142,312,550 (GRCm39) missense probably damaging 1.00
R0732:Gbp2b UTSW 3 142,312,739 (GRCm39) missense probably benign
R1163:Gbp2b UTSW 3 142,304,857 (GRCm39) missense probably damaging 1.00
R1550:Gbp2b UTSW 3 142,312,591 (GRCm39) missense probably damaging 0.99
R1629:Gbp2b UTSW 3 142,316,735 (GRCm39) missense possibly damaging 0.93
R1886:Gbp2b UTSW 3 142,314,063 (GRCm39) missense probably benign
R1887:Gbp2b UTSW 3 142,314,063 (GRCm39) missense probably benign
R2188:Gbp2b UTSW 3 142,314,040 (GRCm39) missense probably benign 0.44
R2261:Gbp2b UTSW 3 142,312,496 (GRCm39) missense probably benign 0.00
R3977:Gbp2b UTSW 3 142,309,470 (GRCm39) missense probably benign 0.02
R4718:Gbp2b UTSW 3 142,304,756 (GRCm39) missense probably damaging 1.00
R4788:Gbp2b UTSW 3 142,317,171 (GRCm39) missense probably benign 0.21
R4807:Gbp2b UTSW 3 142,304,006 (GRCm39) missense probably benign 0.02
R5042:Gbp2b UTSW 3 142,317,224 (GRCm39) missense probably benign 0.03
R5087:Gbp2b UTSW 3 142,304,015 (GRCm39) missense probably damaging 1.00
R5114:Gbp2b UTSW 3 142,303,946 (GRCm39) missense probably damaging 1.00
R5414:Gbp2b UTSW 3 142,304,852 (GRCm39) missense probably damaging 1.00
R5567:Gbp2b UTSW 3 142,317,126 (GRCm39) missense possibly damaging 0.75
R5625:Gbp2b UTSW 3 142,304,806 (GRCm39) missense probably damaging 1.00
R5685:Gbp2b UTSW 3 142,313,919 (GRCm39) missense probably benign
R6030:Gbp2b UTSW 3 142,309,414 (GRCm39) missense probably benign 0.00
R6030:Gbp2b UTSW 3 142,309,414 (GRCm39) missense probably benign 0.00
R6408:Gbp2b UTSW 3 142,323,899 (GRCm39) missense probably benign 0.00
R6500:Gbp2b UTSW 3 142,317,252 (GRCm39) missense probably benign 0.06
R6581:Gbp2b UTSW 3 142,313,999 (GRCm39) nonsense probably null
R6582:Gbp2b UTSW 3 142,316,801 (GRCm39) missense possibly damaging 0.53
R6847:Gbp2b UTSW 3 142,303,940 (GRCm39) missense probably damaging 0.96
R6923:Gbp2b UTSW 3 142,306,320 (GRCm39) missense probably benign 0.01
R7120:Gbp2b UTSW 3 142,312,507 (GRCm39) missense probably benign 0.01
R7255:Gbp2b UTSW 3 142,313,878 (GRCm39) missense probably damaging 1.00
R7454:Gbp2b UTSW 3 142,303,920 (GRCm39) missense possibly damaging 0.75
R7643:Gbp2b UTSW 3 142,309,370 (GRCm39) missense probably benign 0.07
R8039:Gbp2b UTSW 3 142,323,925 (GRCm39) missense probably benign 0.02
R8312:Gbp2b UTSW 3 142,304,815 (GRCm39) missense probably damaging 0.96
R8312:Gbp2b UTSW 3 142,304,812 (GRCm39) missense probably benign
R8391:Gbp2b UTSW 3 142,309,894 (GRCm39) missense probably damaging 1.00
R8418:Gbp2b UTSW 3 142,309,466 (GRCm39) missense probably benign 0.01
R8721:Gbp2b UTSW 3 142,312,705 (GRCm39) missense possibly damaging 0.93
R8842:Gbp2b UTSW 3 142,312,576 (GRCm39) missense probably benign
R8849:Gbp2b UTSW 3 142,313,913 (GRCm39) missense probably benign 0.00
R8874:Gbp2b UTSW 3 142,314,040 (GRCm39) missense probably benign 0.03
R8896:Gbp2b UTSW 3 142,309,327 (GRCm39) missense probably damaging 1.00
R9339:Gbp2b UTSW 3 142,317,178 (GRCm39) missense probably benign 0.01
R9752:Gbp2b UTSW 3 142,313,917 (GRCm39) missense probably benign 0.16
Z1177:Gbp2b UTSW 3 142,310,077 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGAAATGATTGGCTCTGGAAGG -3'
(R):5'- AGCCACCATGAAGCTAAGAGTG -3'

Sequencing Primer
(F):5'- GGGACCTCAAGTTGATTTTAAAACC -3'
(R):5'- CACCATGAAGCTAAGAGTGACATTTG -3'
Posted On 2021-10-11