Incidental Mutation 'R8992:Usp24'
ID 684465
Institutional Source Beutler Lab
Gene Symbol Usp24
Ensembl Gene ENSMUSG00000028514
Gene Name ubiquitin specific peptidase 24
Synonyms 2810030C21Rik, 2700066K03Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8992 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 106316213-106441322 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 106377565 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 956 (H956Q)
Ref Sequence ENSEMBL: ENSMUSP00000133095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094933] [ENSMUST00000165709]
AlphaFold B1AY13
Predicted Effect probably benign
Transcript: ENSMUST00000094933
AA Change: H955Q

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000092538
Gene: ENSMUSG00000028514
AA Change: H955Q

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 882 6e-7 SMART
low complexity region 1031 1059 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1365 1378 N/A INTRINSIC
Pfam:UCH 1685 2036 3.7e-54 PFAM
Pfam:UCH_1 1686 1993 1.8e-27 PFAM
low complexity region 2066 2081 N/A INTRINSIC
low complexity region 2256 2267 N/A INTRINSIC
low complexity region 2576 2592 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165709
AA Change: H956Q

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133095
Gene: ENSMUSG00000028514
AA Change: H956Q

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 883 8e-7 SMART
low complexity region 1032 1060 N/A INTRINSIC
low complexity region 1125 1151 N/A INTRINSIC
low complexity region 1366 1379 N/A INTRINSIC
Pfam:UCH 1686 2037 2e-49 PFAM
Pfam:UCH_1 1687 1994 4e-24 PFAM
low complexity region 2067 2082 N/A INTRINSIC
low complexity region 2257 2268 N/A INTRINSIC
low complexity region 2577 2593 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP24 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd14b A G 9: 106,451,618 D146G probably benign Het
Abhd6 T A 14: 8,028,282 D4E probably benign Het
Atpif1 T C 4: 132,533,374 D34G probably benign Het
Bcr T C 10: 75,131,572 F546S probably damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Ccdc141 A T 2: 77,014,395 W1443R probably damaging Het
Chd7 A G 4: 8,839,589 D1375G probably damaging Het
Chil1 A T 1: 134,187,924 Q223H probably benign Het
Clcn2 A T 16: 20,712,330 F260I probably damaging Het
Cpq A T 15: 33,594,235 D464V probably benign Het
Crygb T C 1: 65,082,141 D9G probably damaging Het
Cyp2b10 A G 7: 25,925,390 K438E unknown Het
Cyp46a1 A T 12: 108,358,107 D381V possibly damaging Het
Dhx40 A C 11: 86,776,756 probably benign Het
Dnase2b G T 3: 146,586,962 P152Q probably damaging Het
Duox1 A T 2: 122,344,705 H1328L probably damaging Het
Ephb6 C T 6: 41,613,359 A15V probably benign Het
Fam168b A G 1: 34,819,781 F102L probably benign Het
Fam3b T A 16: 97,476,394 D128V probably damaging Het
Galnt11 T G 5: 25,264,985 H527Q possibly damaging Het
Gbp2b A T 3: 142,610,969 R460S probably benign Het
Gm7534 G A 4: 134,202,667 T109I probably damaging Het
Hdhd2 A C 18: 76,970,670 S246R possibly damaging Het
Heatr1 T C 13: 12,401,114 M189T probably damaging Het
Ino80 A G 2: 119,379,578 S1411P possibly damaging Het
Jakmip1 A G 5: 37,117,538 T467A probably benign Het
Kcnh2 A G 5: 24,331,870 S239P probably benign Het
Lct T A 1: 128,300,562 T1065S probably damaging Het
Lrrc66 T C 5: 73,629,884 D41G probably benign Het
Mfsd2b A T 12: 4,871,490 D26E probably benign Het
Myh1 A T 11: 67,205,781 M333L probably benign Het
Neurl4 T C 11: 69,908,132 V855A possibly damaging Het
Nfkb2 T A 19: 46,306,865 V80D probably damaging Het
Nop9 T C 14: 55,745,981 S70P possibly damaging Het
Olfr325 A G 11: 58,580,912 S23G probably benign Het
Pcdhb14 G T 18: 37,449,178 D446Y probably damaging Het
Pclo C T 5: 14,669,311 A1154V unknown Het
Pdgfa G T 5: 138,986,222 Q141K probably damaging Het
Plekhh1 G T 12: 79,075,533 L1133F probably damaging Het
Pole A T 5: 110,323,622 N1411Y possibly damaging Het
Primpol A G 8: 46,581,562 probably benign Het
Psmc5 T G 11: 106,261,961 V203G probably damaging Het
Ptgdr C T 14: 44,858,724 C177Y probably damaging Het
Ptgir A T 7: 16,907,295 I171F probably damaging Het
Ptprg T A 14: 12,154,170 H630Q probably benign Het
Ptrh2 A G 11: 86,690,081 T175A possibly damaging Het
Ralgapb A G 2: 158,454,277 T857A probably damaging Het
Rnf24 A G 2: 131,313,277 F10S possibly damaging Het
Rreb1 C A 13: 37,930,376 S570R probably benign Het
Rttn A G 18: 88,977,708 N205S probably benign Het
Rusc1 T C 3: 89,092,058 E139G probably benign Het
Scn2a A G 2: 65,763,898 N1697S probably damaging Het
Serpinb3a T A 1: 107,047,177 M209L probably damaging Het
Shank3 A G 15: 89,548,685 D1211G possibly damaging Het
Slc22a12 C A 19: 6,542,484 R90L possibly damaging Het
Slc6a13 G A 6: 121,336,942 W548* probably null Het
Srfbp1 T A 18: 52,476,320 L59* probably null Het
Ss18 A T 18: 14,670,323 S73T probably damaging Het
Syne1 T C 10: 5,185,508 K189R probably benign Het
Szt2 G T 4: 118,382,788 probably benign Het
Tbx1 T A 16: 18,584,187 H183L probably damaging Het
Thop1 A G 10: 81,080,138 E385G possibly damaging Het
Tmem168 C A 6: 13,602,850 M172I possibly damaging Het
Tmem67 A G 4: 12,058,559 Y513H probably damaging Het
Top1 A G 2: 160,721,001 D709G probably damaging Het
Tprgl A C 4: 154,158,433 S247A probably damaging Het
Trim46 A G 3: 89,236,385 S602P probably damaging Het
Ttc30a1 A T 2: 75,979,907 C611S probably benign Het
Ttc7b T C 12: 100,500,174 K60E probably benign Het
Ttn G A 2: 76,884,471 S8053F unknown Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Vcp T C 4: 42,980,828 T761A probably benign Het
Xpc G A 6: 91,500,974 T309I possibly damaging Het
Zfp560 C T 9: 20,349,599 M129I probably benign Het
Other mutations in Usp24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Usp24 APN 4 106359091 missense probably benign
IGL00340:Usp24 APN 4 106401139 missense probably damaging 0.99
IGL00480:Usp24 APN 4 106368106 missense probably damaging 0.99
IGL00548:Usp24 APN 4 106341298 missense probably damaging 0.96
IGL00655:Usp24 APN 4 106390318 missense probably damaging 0.99
IGL00674:Usp24 APN 4 106372679 splice site probably benign
IGL00718:Usp24 APN 4 106409704 missense probably benign 0.10
IGL00803:Usp24 APN 4 106385526 splice site probably benign
IGL01161:Usp24 APN 4 106436844 missense probably benign 0.02
IGL01344:Usp24 APN 4 106379385 missense possibly damaging 0.73
IGL01374:Usp24 APN 4 106380099 missense possibly damaging 0.86
IGL01485:Usp24 APN 4 106362232 missense probably benign 0.01
IGL01736:Usp24 APN 4 106423461 missense probably benign 0.00
IGL01737:Usp24 APN 4 106387734 missense probably benign 0.03
IGL01862:Usp24 APN 4 106408898 splice site probably benign
IGL01981:Usp24 APN 4 106375768 splice site probably benign
IGL02090:Usp24 APN 4 106411426 missense possibly damaging 0.55
IGL02275:Usp24 APN 4 106387493 missense probably damaging 1.00
IGL02352:Usp24 APN 4 106403925 missense probably damaging 1.00
IGL02359:Usp24 APN 4 106403925 missense probably damaging 1.00
IGL02391:Usp24 APN 4 106407129 missense possibly damaging 0.60
IGL02418:Usp24 APN 4 106436360 missense probably benign 0.07
IGL02537:Usp24 APN 4 106392367 missense probably damaging 1.00
IGL02638:Usp24 APN 4 106438770 splice site probably benign
IGL02638:Usp24 APN 4 106438772 splice site probably benign
IGL02830:Usp24 APN 4 106347387 missense possibly damaging 0.79
IGL03125:Usp24 APN 4 106392402 missense probably benign 0.09
IGL03280:Usp24 APN 4 106380430 missense probably damaging 1.00
IGL03350:Usp24 APN 4 106371079 nonsense probably null
BB010:Usp24 UTSW 4 106428489 missense probably benign
BB020:Usp24 UTSW 4 106428489 missense probably benign
IGL03098:Usp24 UTSW 4 106371033 missense probably benign 0.11
R0035:Usp24 UTSW 4 106368027 missense probably benign 0.18
R0044:Usp24 UTSW 4 106412084 splice site probably benign
R0086:Usp24 UTSW 4 106392360 missense probably damaging 0.98
R0125:Usp24 UTSW 4 106397299 missense possibly damaging 0.76
R0197:Usp24 UTSW 4 106407133 missense probably damaging 1.00
R0240:Usp24 UTSW 4 106414404 nonsense probably null
R0240:Usp24 UTSW 4 106414404 nonsense probably null
R0491:Usp24 UTSW 4 106402105 missense probably benign 0.41
R0687:Usp24 UTSW 4 106420504 missense probably damaging 1.00
R0973:Usp24 UTSW 4 106371079 nonsense probably null
R0973:Usp24 UTSW 4 106413678 splice site probably null
R0973:Usp24 UTSW 4 106371079 nonsense probably null
R0974:Usp24 UTSW 4 106371079 nonsense probably null
R0974:Usp24 UTSW 4 106413678 splice site probably null
R1163:Usp24 UTSW 4 106420960 missense probably benign
R1293:Usp24 UTSW 4 106423553 missense probably benign 0.19
R1333:Usp24 UTSW 4 106342353 missense possibly damaging 0.55
R1476:Usp24 UTSW 4 106361933 missense probably damaging 1.00
R1699:Usp24 UTSW 4 106438827 missense probably damaging 0.99
R1728:Usp24 UTSW 4 106360421 missense possibly damaging 0.85
R1729:Usp24 UTSW 4 106360421 missense possibly damaging 0.85
R1753:Usp24 UTSW 4 106377559 missense probably benign 0.04
R1917:Usp24 UTSW 4 106410286 missense probably damaging 1.00
R2045:Usp24 UTSW 4 106400980 missense possibly damaging 0.54
R2424:Usp24 UTSW 4 106399113 critical splice donor site probably null
R2436:Usp24 UTSW 4 106409645 nonsense probably null
R2513:Usp24 UTSW 4 106379405 splice site probably null
R3824:Usp24 UTSW 4 106379066 missense probably benign
R3831:Usp24 UTSW 4 106362012 critical splice donor site probably null
R3833:Usp24 UTSW 4 106362012 critical splice donor site probably null
R3982:Usp24 UTSW 4 106387883 missense probably benign 0.38
R4022:Usp24 UTSW 4 106379224 splice site probably benign
R4067:Usp24 UTSW 4 106359089 missense possibly damaging 0.68
R4175:Usp24 UTSW 4 106316773 missense probably benign 0.00
R4766:Usp24 UTSW 4 106416048 missense probably damaging 1.00
R4771:Usp24 UTSW 4 106362180 splice site probably null
R4798:Usp24 UTSW 4 106360162 missense possibly damaging 0.82
R4809:Usp24 UTSW 4 106413676 critical splice donor site probably null
R4822:Usp24 UTSW 4 106416047 missense probably damaging 0.98
R4906:Usp24 UTSW 4 106388637 missense probably benign 0.20
R4934:Usp24 UTSW 4 106426546 missense probably benign 0.29
R5074:Usp24 UTSW 4 106420447 missense probably benign 0.12
R5151:Usp24 UTSW 4 106399112 critical splice donor site probably null
R5220:Usp24 UTSW 4 106382303 missense possibly damaging 0.69
R5279:Usp24 UTSW 4 106385424 missense possibly damaging 0.94
R5280:Usp24 UTSW 4 106341214 missense probably benign 0.18
R5285:Usp24 UTSW 4 106407033 missense probably benign 0.00
R5292:Usp24 UTSW 4 106418263 missense probably benign 0.06
R5294:Usp24 UTSW 4 106362357 missense possibly damaging 0.53
R5394:Usp24 UTSW 4 106408013 missense probably damaging 1.00
R5517:Usp24 UTSW 4 106375674 missense probably benign 0.02
R5522:Usp24 UTSW 4 106372721 missense probably damaging 1.00
R5546:Usp24 UTSW 4 106416047 missense probably damaging 0.98
R5756:Usp24 UTSW 4 106362483 missense probably damaging 1.00
R5910:Usp24 UTSW 4 106380468 missense probably damaging 0.99
R5972:Usp24 UTSW 4 106368067 missense probably damaging 0.98
R6285:Usp24 UTSW 4 106374100 splice site probably null
R6370:Usp24 UTSW 4 106380521 missense probably null 0.20
R6630:Usp24 UTSW 4 106387835 missense possibly damaging 0.69
R6754:Usp24 UTSW 4 106360420 missense probably damaging 1.00
R7027:Usp24 UTSW 4 106362244 missense probably benign 0.21
R7088:Usp24 UTSW 4 106387546 missense probably damaging 1.00
R7129:Usp24 UTSW 4 106362215 missense probably damaging 1.00
R7131:Usp24 UTSW 4 106382303 missense possibly damaging 0.69
R7156:Usp24 UTSW 4 106387919 critical splice donor site probably null
R7174:Usp24 UTSW 4 106362681 splice site probably null
R7236:Usp24 UTSW 4 106406305 splice site probably null
R7403:Usp24 UTSW 4 106407035 missense possibly damaging 0.79
R7424:Usp24 UTSW 4 106379107 missense probably benign 0.00
R7475:Usp24 UTSW 4 106342353 missense possibly damaging 0.55
R7505:Usp24 UTSW 4 106379079 missense probably damaging 1.00
R7782:Usp24 UTSW 4 106316574 missense probably damaging 1.00
R7900:Usp24 UTSW 4 106409400 missense probably damaging 1.00
R7933:Usp24 UTSW 4 106428489 missense probably benign
R7940:Usp24 UTSW 4 106430544 missense probably damaging 0.98
R8271:Usp24 UTSW 4 106428514 missense probably damaging 0.98
R8348:Usp24 UTSW 4 106368736 missense possibly damaging 0.82
R8448:Usp24 UTSW 4 106368736 missense possibly damaging 0.82
R8483:Usp24 UTSW 4 106373756 missense probably damaging 1.00
R8546:Usp24 UTSW 4 106402129 missense probably benign 0.01
R8798:Usp24 UTSW 4 106379239 missense probably benign 0.00
R8822:Usp24 UTSW 4 106412213 missense probably benign 0.17
R9002:Usp24 UTSW 4 106418215 missense possibly damaging 0.72
R9037:Usp24 UTSW 4 106379054 missense probably damaging 0.99
R9068:Usp24 UTSW 4 106375678 missense probably benign 0.09
R9096:Usp24 UTSW 4 106397311 missense probably benign 0.00
R9180:Usp24 UTSW 4 106359050 missense possibly damaging 0.71
R9199:Usp24 UTSW 4 106387484 missense probably damaging 1.00
R9201:Usp24 UTSW 4 106420530 missense probably benign 0.36
R9251:Usp24 UTSW 4 106360518 missense probably benign 0.19
R9423:Usp24 UTSW 4 106431670 missense probably damaging 1.00
R9459:Usp24 UTSW 4 106342358 missense probably damaging 1.00
R9472:Usp24 UTSW 4 106403931 missense probably benign 0.00
R9483:Usp24 UTSW 4 106362182 missense probably damaging 0.99
R9534:Usp24 UTSW 4 106407115 missense probably damaging 0.97
R9653:Usp24 UTSW 4 106347367 missense probably benign 0.03
R9712:Usp24 UTSW 4 106347367 missense probably benign 0.03
X0024:Usp24 UTSW 4 106360446 missense probably benign 0.09
X0028:Usp24 UTSW 4 106368055 missense probably benign 0.01
X0066:Usp24 UTSW 4 106355731 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGGCCTCTCTTAGAGCAGTG -3'
(R):5'- ACATCTTCACTTGGCACTGTG -3'

Sequencing Primer
(F):5'- CTCTTAGAGCAGTGGTACTCAC -3'
(R):5'- ACCTAGAGTTCACTGAATGGC -3'
Posted On 2021-10-11