Incidental Mutation 'R8992:Tyw1'
ID 684475
Institutional Source Beutler Lab
Gene Symbol Tyw1
Ensembl Gene ENSMUSG00000056310
Gene Name tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
Synonyms Rsafd1
MMRRC Submission 068823-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8992 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 130284460-130370404 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 130298065 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 202 (R202Q)
Ref Sequence ENSEMBL: ENSMUSP00000037173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040213] [ENSMUST00000044204] [ENSMUST00000100662] [ENSMUST00000147619]
AlphaFold Q8BJM7
Predicted Effect probably damaging
Transcript: ENSMUST00000040213
AA Change: R202Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037173
Gene: ENSMUSG00000056310
AA Change: R202Q

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 1.6e-27 PFAM
low complexity region 276 288 N/A INTRINSIC
Pfam:Radical_SAM 399 581 1.1e-29 PFAM
Pfam:Wyosine_form 583 646 3.6e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000044204
AA Change: R202Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047318
Gene: ENSMUSG00000056310
AA Change: R202Q

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 1.5e-27 PFAM
low complexity region 276 288 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
transmembrane domain 423 445 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100662
AA Change: R202Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098226
Gene: ENSMUSG00000056310
AA Change: R202Q

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 4.9e-28 PFAM
low complexity region 276 288 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147619
AA Change: R179Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123693
Gene: ENSMUSG00000056310
AA Change: R179Q

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 50 201 4.3e-28 PFAM
Meta Mutation Damage Score 0.3244 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Wybutosine (yW) is a hypermodified guanosine found in phenylalanine tRNA adjacent to the anticodon that stabilizes codon-anticodon interactions in the ribosome. In yeast, the homolog of this gene is essential for the synthesis of wybutosine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd14b A G 9: 106,328,817 (GRCm39) D146G probably benign Het
Abhd6 T A 14: 8,028,282 (GRCm38) D4E probably benign Het
Atp5if1 T C 4: 132,260,685 (GRCm39) D34G probably benign Het
Bcr T C 10: 74,967,404 (GRCm39) F546S probably damaging Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Ccdc141 A T 2: 76,844,739 (GRCm39) W1443R probably damaging Het
Chd7 A G 4: 8,839,589 (GRCm39) D1375G probably damaging Het
Chi3l1 A T 1: 134,115,662 (GRCm39) Q223H probably benign Het
Clcn2 A T 16: 20,531,080 (GRCm39) F260I probably damaging Het
Cpq A T 15: 33,594,381 (GRCm39) D464V probably benign Het
Crygb T C 1: 65,121,300 (GRCm39) D9G probably damaging Het
Cyp2b10 A G 7: 25,624,815 (GRCm39) K438E unknown Het
Cyp46a1 A T 12: 108,324,366 (GRCm39) D381V possibly damaging Het
Dhx40 A C 11: 86,667,582 (GRCm39) probably benign Het
Dnase2b G T 3: 146,292,717 (GRCm39) P152Q probably damaging Het
Duox1 A T 2: 122,175,186 (GRCm39) H1328L probably damaging Het
Ephb6 C T 6: 41,590,293 (GRCm39) A15V probably benign Het
Fam168b A G 1: 34,858,862 (GRCm39) F102L probably benign Het
Fam3b T A 16: 97,277,594 (GRCm39) D128V probably damaging Het
Galnt11 T G 5: 25,469,983 (GRCm39) H527Q possibly damaging Het
Gbp2b A T 3: 142,316,730 (GRCm39) R460S probably benign Het
Hdhd2 A C 18: 77,058,366 (GRCm39) S246R possibly damaging Het
Heatr1 T C 13: 12,415,995 (GRCm39) M189T probably damaging Het
Ift70a1 A T 2: 75,810,251 (GRCm39) C611S probably benign Het
Ino80 A G 2: 119,210,059 (GRCm39) S1411P possibly damaging Het
Jakmip1 A G 5: 37,274,882 (GRCm39) T467A probably benign Het
Kcnh2 A G 5: 24,536,868 (GRCm39) S239P probably benign Het
Lct T A 1: 128,228,299 (GRCm39) T1065S probably damaging Het
Lrrc66 T C 5: 73,787,227 (GRCm39) D41G probably benign Het
Mfsd2b A T 12: 4,921,490 (GRCm39) D26E probably benign Het
Myh1 A T 11: 67,096,607 (GRCm39) M333L probably benign Het
Neurl4 T C 11: 69,798,958 (GRCm39) V855A possibly damaging Het
Nfkb2 T A 19: 46,295,304 (GRCm39) V80D probably damaging Het
Nop9 T C 14: 55,983,438 (GRCm39) S70P possibly damaging Het
Or2t46 A G 11: 58,471,738 (GRCm39) S23G probably benign Het
Pcdhb14 G T 18: 37,582,231 (GRCm39) D446Y probably damaging Het
Pclo C T 5: 14,719,325 (GRCm39) A1154V unknown Het
Pdgfa G T 5: 138,971,977 (GRCm39) Q141K probably damaging Het
Plekhh1 G T 12: 79,122,307 (GRCm39) L1133F probably damaging Het
Pole A T 5: 110,471,488 (GRCm39) N1411Y possibly damaging Het
Primpol A G 8: 47,034,597 (GRCm39) probably benign Het
Psmc5 T G 11: 106,152,787 (GRCm39) V203G probably damaging Het
Ptgdr C T 14: 45,096,181 (GRCm39) C177Y probably damaging Het
Ptgir A T 7: 16,641,220 (GRCm39) I171F probably damaging Het
Ptprg T A 14: 12,154,170 (GRCm38) H630Q probably benign Het
Ptrh2 A G 11: 86,580,907 (GRCm39) T175A possibly damaging Het
Ralgapb A G 2: 158,296,197 (GRCm39) T857A probably damaging Het
Rnf24 A G 2: 131,155,197 (GRCm39) F10S possibly damaging Het
Rreb1 C A 13: 38,114,352 (GRCm39) S570R probably benign Het
Rttn A G 18: 88,995,832 (GRCm39) N205S probably benign Het
Rusc1 T C 3: 88,999,365 (GRCm39) E139G probably benign Het
Scn2a A G 2: 65,594,242 (GRCm39) N1697S probably damaging Het
Serpinb3a T A 1: 106,974,907 (GRCm39) M209L probably damaging Het
Shank3 A G 15: 89,432,888 (GRCm39) D1211G possibly damaging Het
Slc22a12 C A 19: 6,592,514 (GRCm39) R90L possibly damaging Het
Slc6a13 G A 6: 121,313,901 (GRCm39) W548* probably null Het
Srfbp1 T A 18: 52,609,392 (GRCm39) L59* probably null Het
Ss18 A T 18: 14,803,380 (GRCm39) S73T probably damaging Het
Syne1 T C 10: 5,135,508 (GRCm39) K189R probably benign Het
Szt2 G T 4: 118,239,985 (GRCm39) probably benign Het
Tbx1 T A 16: 18,402,937 (GRCm39) H183L probably damaging Het
Thop1 A G 10: 80,915,972 (GRCm39) E385G possibly damaging Het
Tmem168 C A 6: 13,602,849 (GRCm39) M172I possibly damaging Het
Tmem67 A G 4: 12,058,559 (GRCm39) Y513H probably damaging Het
Top1 A G 2: 160,562,921 (GRCm39) D709G probably damaging Het
Tprg1l A C 4: 154,242,890 (GRCm39) S247A probably damaging Het
Trim46 A G 3: 89,143,692 (GRCm39) S602P probably damaging Het
Ttc7b T C 12: 100,466,433 (GRCm39) K60E probably benign Het
Ttn G A 2: 76,714,815 (GRCm39) S8053F unknown Het
Usp24 T A 4: 106,234,762 (GRCm39) H956Q probably benign Het
Vcp T C 4: 42,980,828 (GRCm39) T761A probably benign Het
Xpc G A 6: 91,477,956 (GRCm39) T309I possibly damaging Het
Zfp560 C T 9: 20,260,895 (GRCm39) M129I probably benign Het
Zpld2 G A 4: 133,929,978 (GRCm39) T109I probably damaging Het
Other mutations in Tyw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02329:Tyw1 APN 5 130,295,921 (GRCm39) missense probably benign 0.20
IGL02873:Tyw1 APN 5 130,364,171 (GRCm39) missense probably benign 0.00
IGL02879:Tyw1 APN 5 130,325,612 (GRCm39) missense probably damaging 1.00
IGL03080:Tyw1 APN 5 130,295,896 (GRCm39) missense probably damaging 1.00
IGL03291:Tyw1 APN 5 130,328,834 (GRCm39) missense probably damaging 1.00
IGL03297:Tyw1 APN 5 130,369,575 (GRCm39) missense probably damaging 1.00
remnant UTSW 5 130,291,762 (GRCm39) missense probably damaging 0.99
schimmel UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
tyrone UTSW 5 130,325,520 (GRCm39) nonsense probably null
yang UTSW 5 130,287,876 (GRCm39) missense probably damaging 0.98
R1420:Tyw1 UTSW 5 130,303,586 (GRCm39) critical splice donor site probably null
R1650:Tyw1 UTSW 5 130,317,752 (GRCm39) missense possibly damaging 0.91
R1674:Tyw1 UTSW 5 130,298,169 (GRCm39) missense probably benign 0.01
R1789:Tyw1 UTSW 5 130,287,834 (GRCm39) missense probably damaging 0.99
R1996:Tyw1 UTSW 5 130,291,652 (GRCm39) splice site probably benign
R2421:Tyw1 UTSW 5 130,298,101 (GRCm39) missense probably damaging 1.00
R3913:Tyw1 UTSW 5 130,287,876 (GRCm39) missense probably damaging 0.98
R4412:Tyw1 UTSW 5 130,364,073 (GRCm39) splice site probably null
R4835:Tyw1 UTSW 5 130,305,899 (GRCm39) missense probably benign
R5058:Tyw1 UTSW 5 130,305,927 (GRCm39) missense probably benign 0.03
R5190:Tyw1 UTSW 5 130,296,756 (GRCm39) nonsense probably null
R5398:Tyw1 UTSW 5 130,305,998 (GRCm39) intron probably benign
R5459:Tyw1 UTSW 5 130,303,547 (GRCm39) missense probably damaging 1.00
R5597:Tyw1 UTSW 5 130,303,498 (GRCm39) missense probably benign 0.00
R5704:Tyw1 UTSW 5 130,310,863 (GRCm39) nonsense probably null
R5825:Tyw1 UTSW 5 130,296,929 (GRCm39) missense probably damaging 0.99
R5887:Tyw1 UTSW 5 130,354,540 (GRCm39) missense probably damaging 1.00
R6072:Tyw1 UTSW 5 130,296,752 (GRCm39) missense possibly damaging 0.92
R6349:Tyw1 UTSW 5 130,305,872 (GRCm39) missense possibly damaging 0.82
R6366:Tyw1 UTSW 5 130,310,792 (GRCm39) unclassified probably benign
R7012:Tyw1 UTSW 5 130,306,571 (GRCm39) splice site probably null
R7259:Tyw1 UTSW 5 130,296,713 (GRCm39) splice site probably null
R7328:Tyw1 UTSW 5 130,291,685 (GRCm39) missense probably benign 0.08
R7555:Tyw1 UTSW 5 130,303,547 (GRCm39) missense probably damaging 1.00
R8006:Tyw1 UTSW 5 130,296,913 (GRCm39) missense possibly damaging 0.87
R8171:Tyw1 UTSW 5 130,328,855 (GRCm39) missense probably benign 0.19
R8196:Tyw1 UTSW 5 130,328,862 (GRCm39) missense probably damaging 1.00
R8714:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R8715:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R8716:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R8970:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R9117:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R9119:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R9120:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R9172:Tyw1 UTSW 5 130,325,520 (GRCm39) nonsense probably null
R9204:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R9205:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R9207:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R9325:Tyw1 UTSW 5 130,291,762 (GRCm39) missense probably damaging 0.99
R9364:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R9368:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R9369:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R9470:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R9471:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R9566:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
R9567:Tyw1 UTSW 5 130,298,065 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTGGAAGCCTGCTTTAG -3'
(R):5'- ATCCCCAGGATGCAATTCG -3'

Sequencing Primer
(F):5'- CTGGAAGCCTGCTTTAGAGGAC -3'
(R):5'- CAGGATGCAATTCGCCTTG -3'
Posted On 2021-10-11