Incidental Mutation 'R8992:Xpc'
ID684479
Institutional Source Beutler Lab
Gene Symbol Xpc
Ensembl Gene ENSMUSG00000030094
Gene Namexeroderma pigmentosum, complementation group C
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.534) question?
Stock #R8992 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location91489305-91515888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 91500974 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 309 (T309I)
Ref Sequence ENSEMBL: ENSMUSP00000032182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032182]
AlphaFold P51612
Predicted Effect possibly damaging
Transcript: ENSMUST00000032182
AA Change: T309I

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032182
Gene: ENSMUSG00000030094
AA Change: T309I

DomainStartEndE-ValueType
low complexity region 69 82 N/A INTRINSIC
low complexity region 106 115 N/A INTRINSIC
low complexity region 118 142 N/A INTRINSIC
low complexity region 299 315 N/A INTRINSIC
low complexity region 335 352 N/A INTRINSIC
low complexity region 371 387 N/A INTRINSIC
low complexity region 425 439 N/A INTRINSIC
Pfam:Rad4 485 619 6.4e-26 PFAM
BHD_1 623 675 4.09e-25 SMART
BHD_2 677 737 4.96e-24 SMART
BHD_3 744 818 4.83e-45 SMART
low complexity region 826 835 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the nucleotide excision repair (NER) pathway. There are multiple components involved in the NER pathway, including Xeroderma pigmentosum (XP) A-G and V, Cockayne syndrome (CS) A and B, and trichothiodystrophy (TTD) group A, etc. This component, XPC, plays an important role in the early steps of global genome NER, especially in damage recognition, open complex formation, and repair protein complex formation. Mutations in this gene or some other NER components result in Xeroderma pigmentosum, a rare autosomal recessive disorder characterized by increased sensitivity to sunlight with the development of carcinomas at an early age. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous mutants are highly susceptible to ultraviolet-induced skin tumors and exhibit a 30-fold higher somatic frequency of gene mutations at one year of age. Mutant cells exhibit impaired nucleotide excision repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd14b A G 9: 106,451,618 D146G probably benign Het
Abhd6 T A 14: 8,028,282 D4E probably benign Het
Atpif1 T C 4: 132,533,374 D34G probably benign Het
Bcr T C 10: 75,131,572 F546S probably damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Ccdc141 A T 2: 77,014,395 W1443R probably damaging Het
Chd7 A G 4: 8,839,589 D1375G probably damaging Het
Chil1 A T 1: 134,187,924 Q223H probably benign Het
Clcn2 A T 16: 20,712,330 F260I probably damaging Het
Cpq A T 15: 33,594,235 D464V probably benign Het
Crygb T C 1: 65,082,141 D9G probably damaging Het
Cyp2b10 A G 7: 25,925,390 K438E unknown Het
Cyp46a1 A T 12: 108,358,107 D381V possibly damaging Het
Dnase2b G T 3: 146,586,962 P152Q probably damaging Het
Duox1 A T 2: 122,344,705 H1328L probably damaging Het
Ephb6 C T 6: 41,613,359 A15V probably benign Het
Fam168b A G 1: 34,819,781 F102L probably benign Het
Fam3b T A 16: 97,476,394 D128V probably damaging Het
Galnt11 T G 5: 25,264,985 H527Q possibly damaging Het
Gbp2b A T 3: 142,610,969 R460S probably benign Het
Gm7534 G A 4: 134,202,667 T109I probably damaging Het
Hdhd2 A C 18: 76,970,670 S246R possibly damaging Het
Heatr1 T C 13: 12,401,114 M189T probably damaging Het
Ino80 A G 2: 119,379,578 S1411P possibly damaging Het
Jakmip1 A G 5: 37,117,538 T467A probably benign Het
Kcnh2 A G 5: 24,331,870 S239P probably benign Het
Lct T A 1: 128,300,562 T1065S probably damaging Het
Lrrc66 T C 5: 73,629,884 D41G probably benign Het
Mfsd2b A T 12: 4,871,490 D26E probably benign Het
Myh1 A T 11: 67,205,781 M333L probably benign Het
Neurl4 T C 11: 69,908,132 V855A possibly damaging Het
Nfkb2 T A 19: 46,306,865 V80D probably damaging Het
Nop9 T C 14: 55,745,981 S70P possibly damaging Het
Olfr325 A G 11: 58,580,912 S23G probably benign Het
Pcdhb14 G T 18: 37,449,178 D446Y probably damaging Het
Pclo C T 5: 14,669,311 A1154V unknown Het
Pdgfa G T 5: 138,986,222 Q141K probably damaging Het
Plekhh1 G T 12: 79,075,533 L1133F probably damaging Het
Pole A T 5: 110,323,622 N1411Y possibly damaging Het
Psmc5 T G 11: 106,261,961 V203G probably damaging Het
Ptgdr C T 14: 44,858,724 C177Y probably damaging Het
Ptgir A T 7: 16,907,295 I171F probably damaging Het
Ptprg T A 14: 12,154,170 H630Q probably benign Het
Ptrh2 A G 11: 86,690,081 T175A possibly damaging Het
Ralgapb A G 2: 158,454,277 T857A probably damaging Het
Rnf24 A G 2: 131,313,277 F10S possibly damaging Het
Rreb1 C A 13: 37,930,376 S570R probably benign Het
Rttn A G 18: 88,977,708 N205S probably benign Het
Rusc1 T C 3: 89,092,058 E139G probably benign Het
Scn2a A G 2: 65,763,898 N1697S probably damaging Het
Serpinb3a T A 1: 107,047,177 M209L probably damaging Het
Shank3 A G 15: 89,548,685 D1211G possibly damaging Het
Slc22a12 C A 19: 6,542,484 R90L possibly damaging Het
Slc6a13 G A 6: 121,336,942 W548* probably null Het
Srfbp1 T A 18: 52,476,320 L59* probably null Het
Ss18 A T 18: 14,670,323 S73T probably damaging Het
Syne1 T C 10: 5,185,508 K189R probably benign Het
Tbx1 T A 16: 18,584,187 H183L probably damaging Het
Thop1 A G 10: 81,080,138 E385G possibly damaging Het
Tmem168 C A 6: 13,602,850 M172I possibly damaging Het
Tmem67 A G 4: 12,058,559 Y513H probably damaging Het
Top1 A G 2: 160,721,001 D709G probably damaging Het
Tprgl A C 4: 154,158,433 S247A probably damaging Het
Trim46 A G 3: 89,236,385 S602P probably damaging Het
Ttc30a1 A T 2: 75,979,907 C611S probably benign Het
Ttc7b T C 12: 100,500,174 K60E probably benign Het
Ttn G A 2: 76,884,471 S8053F unknown Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Usp24 T A 4: 106,377,565 H956Q probably benign Het
Vcp T C 4: 42,980,828 T761A probably benign Het
Zfp560 C T 9: 20,349,599 M129I probably benign Het
Other mutations in Xpc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Xpc APN 6 91492264 unclassified probably benign
IGL01108:Xpc APN 6 91493005 missense probably damaging 1.00
IGL01310:Xpc APN 6 91490107 missense probably benign 0.02
IGL01323:Xpc APN 6 91492353 missense probably damaging 1.00
IGL01350:Xpc APN 6 91500011 missense probably benign 0.01
IGL01656:Xpc APN 6 91505467 missense probably damaging 0.98
IGL01922:Xpc APN 6 91505425 missense probably damaging 1.00
IGL02412:Xpc APN 6 91499785 missense probably benign 0.01
IGL02448:Xpc APN 6 91515744 missense probably benign 0.00
IGL02571:Xpc APN 6 91504071 missense probably benign 0.00
IGL02937:Xpc APN 6 91500137 missense probably damaging 1.00
IGL02951:Xpc APN 6 91506849 missense probably damaging 1.00
IGL03033:Xpc APN 6 91491315 splice site probably null
IGL03248:Xpc APN 6 91504583 missense probably damaging 0.99
IGL03046:Xpc UTSW 6 91510481 missense probably damaging 1.00
R0031:Xpc UTSW 6 91491226 missense probably benign 0.01
R0173:Xpc UTSW 6 91504735 unclassified probably benign
R0285:Xpc UTSW 6 91498064 missense probably damaging 0.99
R0454:Xpc UTSW 6 91491226 missense probably benign 0.01
R0535:Xpc UTSW 6 91504578 missense possibly damaging 0.92
R0554:Xpc UTSW 6 91491226 missense probably benign 0.01
R0759:Xpc UTSW 6 91498142 missense probably damaging 0.99
R1426:Xpc UTSW 6 91493238 missense probably damaging 1.00
R1478:Xpc UTSW 6 91508528 missense possibly damaging 0.94
R1676:Xpc UTSW 6 91492947 missense possibly damaging 0.56
R1969:Xpc UTSW 6 91501025 splice site probably null
R2138:Xpc UTSW 6 91498122 nonsense probably null
R2237:Xpc UTSW 6 91498108 missense probably damaging 1.00
R4580:Xpc UTSW 6 91500011 missense probably benign 0.01
R5318:Xpc UTSW 6 91493010 missense probably damaging 1.00
R5567:Xpc UTSW 6 91498135 missense probably damaging 1.00
R5681:Xpc UTSW 6 91504120 missense probably damaging 1.00
R6022:Xpc UTSW 6 91499636 missense probably damaging 0.96
R6791:Xpc UTSW 6 91506857 missense probably benign 0.01
R6794:Xpc UTSW 6 91506857 missense probably benign 0.01
R6983:Xpc UTSW 6 91504023 missense probably damaging 0.99
R7214:Xpc UTSW 6 91492338 missense probably damaging 1.00
R7442:Xpc UTSW 6 91504649 missense probably damaging 1.00
R7524:Xpc UTSW 6 91499531 missense probably benign 0.23
R7581:Xpc UTSW 6 91498017 splice site probably benign
R8002:Xpc UTSW 6 91492305 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTCAGGCTGCATGAATATCTAC -3'
(R):5'- GTCTCTGCAGCATCACTTACAAC -3'

Sequencing Primer
(F):5'- AATATGACCCTGATCGGCTG -3'
(R):5'- TTACAACAGTCTCCCGAGGG -3'
Posted On2021-10-11