Incidental Mutation 'R8992:Xpc'
ID 684479
Institutional Source Beutler Lab
Gene Symbol Xpc
Ensembl Gene ENSMUSG00000030094
Gene Name xeroderma pigmentosum, complementation group C
Synonyms
MMRRC Submission 068823-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.315) question?
Stock # R8992 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 91466287-91492870 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 91477956 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 309 (T309I)
Ref Sequence ENSEMBL: ENSMUSP00000032182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032182]
AlphaFold P51612
Predicted Effect possibly damaging
Transcript: ENSMUST00000032182
AA Change: T309I

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032182
Gene: ENSMUSG00000030094
AA Change: T309I

DomainStartEndE-ValueType
low complexity region 69 82 N/A INTRINSIC
low complexity region 106 115 N/A INTRINSIC
low complexity region 118 142 N/A INTRINSIC
low complexity region 299 315 N/A INTRINSIC
low complexity region 335 352 N/A INTRINSIC
low complexity region 371 387 N/A INTRINSIC
low complexity region 425 439 N/A INTRINSIC
Pfam:Rad4 485 619 6.4e-26 PFAM
BHD_1 623 675 4.09e-25 SMART
BHD_2 677 737 4.96e-24 SMART
BHD_3 744 818 4.83e-45 SMART
low complexity region 826 835 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the nucleotide excision repair (NER) pathway. There are multiple components involved in the NER pathway, including Xeroderma pigmentosum (XP) A-G and V, Cockayne syndrome (CS) A and B, and trichothiodystrophy (TTD) group A, etc. This component, XPC, plays an important role in the early steps of global genome NER, especially in damage recognition, open complex formation, and repair protein complex formation. Mutations in this gene or some other NER components result in Xeroderma pigmentosum, a rare autosomal recessive disorder characterized by increased sensitivity to sunlight with the development of carcinomas at an early age. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous mutants are highly susceptible to ultraviolet-induced skin tumors and exhibit a 30-fold higher somatic frequency of gene mutations at one year of age. Mutant cells exhibit impaired nucleotide excision repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd14b A G 9: 106,328,817 (GRCm39) D146G probably benign Het
Abhd6 T A 14: 8,028,282 (GRCm38) D4E probably benign Het
Atp5if1 T C 4: 132,260,685 (GRCm39) D34G probably benign Het
Bcr T C 10: 74,967,404 (GRCm39) F546S probably damaging Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Ccdc141 A T 2: 76,844,739 (GRCm39) W1443R probably damaging Het
Chd7 A G 4: 8,839,589 (GRCm39) D1375G probably damaging Het
Chi3l1 A T 1: 134,115,662 (GRCm39) Q223H probably benign Het
Clcn2 A T 16: 20,531,080 (GRCm39) F260I probably damaging Het
Cpq A T 15: 33,594,381 (GRCm39) D464V probably benign Het
Crygb T C 1: 65,121,300 (GRCm39) D9G probably damaging Het
Cyp2b10 A G 7: 25,624,815 (GRCm39) K438E unknown Het
Cyp46a1 A T 12: 108,324,366 (GRCm39) D381V possibly damaging Het
Dhx40 A C 11: 86,667,582 (GRCm39) probably benign Het
Dnase2b G T 3: 146,292,717 (GRCm39) P152Q probably damaging Het
Duox1 A T 2: 122,175,186 (GRCm39) H1328L probably damaging Het
Ephb6 C T 6: 41,590,293 (GRCm39) A15V probably benign Het
Fam168b A G 1: 34,858,862 (GRCm39) F102L probably benign Het
Fam3b T A 16: 97,277,594 (GRCm39) D128V probably damaging Het
Galnt11 T G 5: 25,469,983 (GRCm39) H527Q possibly damaging Het
Gbp2b A T 3: 142,316,730 (GRCm39) R460S probably benign Het
Hdhd2 A C 18: 77,058,366 (GRCm39) S246R possibly damaging Het
Heatr1 T C 13: 12,415,995 (GRCm39) M189T probably damaging Het
Ift70a1 A T 2: 75,810,251 (GRCm39) C611S probably benign Het
Ino80 A G 2: 119,210,059 (GRCm39) S1411P possibly damaging Het
Jakmip1 A G 5: 37,274,882 (GRCm39) T467A probably benign Het
Kcnh2 A G 5: 24,536,868 (GRCm39) S239P probably benign Het
Lct T A 1: 128,228,299 (GRCm39) T1065S probably damaging Het
Lrrc66 T C 5: 73,787,227 (GRCm39) D41G probably benign Het
Mfsd2b A T 12: 4,921,490 (GRCm39) D26E probably benign Het
Myh1 A T 11: 67,096,607 (GRCm39) M333L probably benign Het
Neurl4 T C 11: 69,798,958 (GRCm39) V855A possibly damaging Het
Nfkb2 T A 19: 46,295,304 (GRCm39) V80D probably damaging Het
Nop9 T C 14: 55,983,438 (GRCm39) S70P possibly damaging Het
Or2t46 A G 11: 58,471,738 (GRCm39) S23G probably benign Het
Pcdhb14 G T 18: 37,582,231 (GRCm39) D446Y probably damaging Het
Pclo C T 5: 14,719,325 (GRCm39) A1154V unknown Het
Pdgfa G T 5: 138,971,977 (GRCm39) Q141K probably damaging Het
Plekhh1 G T 12: 79,122,307 (GRCm39) L1133F probably damaging Het
Pole A T 5: 110,471,488 (GRCm39) N1411Y possibly damaging Het
Primpol A G 8: 47,034,597 (GRCm39) probably benign Het
Psmc5 T G 11: 106,152,787 (GRCm39) V203G probably damaging Het
Ptgdr C T 14: 45,096,181 (GRCm39) C177Y probably damaging Het
Ptgir A T 7: 16,641,220 (GRCm39) I171F probably damaging Het
Ptprg T A 14: 12,154,170 (GRCm38) H630Q probably benign Het
Ptrh2 A G 11: 86,580,907 (GRCm39) T175A possibly damaging Het
Ralgapb A G 2: 158,296,197 (GRCm39) T857A probably damaging Het
Rnf24 A G 2: 131,155,197 (GRCm39) F10S possibly damaging Het
Rreb1 C A 13: 38,114,352 (GRCm39) S570R probably benign Het
Rttn A G 18: 88,995,832 (GRCm39) N205S probably benign Het
Rusc1 T C 3: 88,999,365 (GRCm39) E139G probably benign Het
Scn2a A G 2: 65,594,242 (GRCm39) N1697S probably damaging Het
Serpinb3a T A 1: 106,974,907 (GRCm39) M209L probably damaging Het
Shank3 A G 15: 89,432,888 (GRCm39) D1211G possibly damaging Het
Slc22a12 C A 19: 6,592,514 (GRCm39) R90L possibly damaging Het
Slc6a13 G A 6: 121,313,901 (GRCm39) W548* probably null Het
Srfbp1 T A 18: 52,609,392 (GRCm39) L59* probably null Het
Ss18 A T 18: 14,803,380 (GRCm39) S73T probably damaging Het
Syne1 T C 10: 5,135,508 (GRCm39) K189R probably benign Het
Szt2 G T 4: 118,239,985 (GRCm39) probably benign Het
Tbx1 T A 16: 18,402,937 (GRCm39) H183L probably damaging Het
Thop1 A G 10: 80,915,972 (GRCm39) E385G possibly damaging Het
Tmem168 C A 6: 13,602,849 (GRCm39) M172I possibly damaging Het
Tmem67 A G 4: 12,058,559 (GRCm39) Y513H probably damaging Het
Top1 A G 2: 160,562,921 (GRCm39) D709G probably damaging Het
Tprg1l A C 4: 154,242,890 (GRCm39) S247A probably damaging Het
Trim46 A G 3: 89,143,692 (GRCm39) S602P probably damaging Het
Ttc7b T C 12: 100,466,433 (GRCm39) K60E probably benign Het
Ttn G A 2: 76,714,815 (GRCm39) S8053F unknown Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Usp24 T A 4: 106,234,762 (GRCm39) H956Q probably benign Het
Vcp T C 4: 42,980,828 (GRCm39) T761A probably benign Het
Zfp560 C T 9: 20,260,895 (GRCm39) M129I probably benign Het
Zpld2 G A 4: 133,929,978 (GRCm39) T109I probably damaging Het
Other mutations in Xpc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Xpc APN 6 91,469,246 (GRCm39) unclassified probably benign
IGL01108:Xpc APN 6 91,469,987 (GRCm39) missense probably damaging 1.00
IGL01310:Xpc APN 6 91,467,089 (GRCm39) missense probably benign 0.02
IGL01323:Xpc APN 6 91,469,335 (GRCm39) missense probably damaging 1.00
IGL01350:Xpc APN 6 91,476,993 (GRCm39) missense probably benign 0.01
IGL01656:Xpc APN 6 91,482,449 (GRCm39) missense probably damaging 0.98
IGL01922:Xpc APN 6 91,482,407 (GRCm39) missense probably damaging 1.00
IGL02412:Xpc APN 6 91,476,767 (GRCm39) missense probably benign 0.01
IGL02448:Xpc APN 6 91,492,726 (GRCm39) missense probably benign 0.00
IGL02571:Xpc APN 6 91,481,053 (GRCm39) missense probably benign 0.00
IGL02937:Xpc APN 6 91,477,119 (GRCm39) missense probably damaging 1.00
IGL02951:Xpc APN 6 91,483,831 (GRCm39) missense probably damaging 1.00
IGL03033:Xpc APN 6 91,468,297 (GRCm39) splice site probably null
IGL03248:Xpc APN 6 91,481,565 (GRCm39) missense probably damaging 0.99
IGL03046:Xpc UTSW 6 91,487,463 (GRCm39) missense probably damaging 1.00
R0031:Xpc UTSW 6 91,468,208 (GRCm39) missense probably benign 0.01
R0173:Xpc UTSW 6 91,481,717 (GRCm39) unclassified probably benign
R0285:Xpc UTSW 6 91,475,046 (GRCm39) missense probably damaging 0.99
R0454:Xpc UTSW 6 91,468,208 (GRCm39) missense probably benign 0.01
R0535:Xpc UTSW 6 91,481,560 (GRCm39) missense possibly damaging 0.92
R0554:Xpc UTSW 6 91,468,208 (GRCm39) missense probably benign 0.01
R0759:Xpc UTSW 6 91,475,124 (GRCm39) missense probably damaging 0.99
R1426:Xpc UTSW 6 91,470,220 (GRCm39) missense probably damaging 1.00
R1478:Xpc UTSW 6 91,485,510 (GRCm39) missense possibly damaging 0.94
R1676:Xpc UTSW 6 91,469,929 (GRCm39) missense possibly damaging 0.56
R1969:Xpc UTSW 6 91,478,007 (GRCm39) splice site probably null
R2138:Xpc UTSW 6 91,475,104 (GRCm39) nonsense probably null
R2237:Xpc UTSW 6 91,475,090 (GRCm39) missense probably damaging 1.00
R4580:Xpc UTSW 6 91,476,993 (GRCm39) missense probably benign 0.01
R5318:Xpc UTSW 6 91,469,992 (GRCm39) missense probably damaging 1.00
R5567:Xpc UTSW 6 91,475,117 (GRCm39) missense probably damaging 1.00
R5681:Xpc UTSW 6 91,481,102 (GRCm39) missense probably damaging 1.00
R6022:Xpc UTSW 6 91,476,618 (GRCm39) missense probably damaging 0.96
R6791:Xpc UTSW 6 91,483,839 (GRCm39) missense probably benign 0.01
R6794:Xpc UTSW 6 91,483,839 (GRCm39) missense probably benign 0.01
R6983:Xpc UTSW 6 91,481,005 (GRCm39) missense probably damaging 0.99
R7214:Xpc UTSW 6 91,469,320 (GRCm39) missense probably damaging 1.00
R7442:Xpc UTSW 6 91,481,631 (GRCm39) missense probably damaging 1.00
R7524:Xpc UTSW 6 91,476,513 (GRCm39) missense probably benign 0.23
R7581:Xpc UTSW 6 91,474,999 (GRCm39) splice site probably benign
R8002:Xpc UTSW 6 91,469,287 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTCAGGCTGCATGAATATCTAC -3'
(R):5'- GTCTCTGCAGCATCACTTACAAC -3'

Sequencing Primer
(F):5'- AATATGACCCTGATCGGCTG -3'
(R):5'- TTACAACAGTCTCCCGAGGG -3'
Posted On 2021-10-11