Incidental Mutation 'R8992:Cyp2b10'
ID 684482
Institutional Source Beutler Lab
Gene Symbol Cyp2b10
Ensembl Gene ENSMUSG00000030483
Gene Name cytochrome P450, family 2, subfamily b, polypeptide 10
Synonyms p16, Cyp2b, Cyp2b20, phenobarbitol inducible, type b
MMRRC Submission 068823-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.102) question?
Stock # R8992 (G1)
Quality Score 99.0078
Status Validated
Chromosome 7
Chromosomal Location 25597083-25626049 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25624815 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 438 (K438E)
Ref Sequence ENSEMBL: ENSMUSP00000005477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005477] [ENSMUST00000072438]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000005477
AA Change: K438E
SMART Domains Protein: ENSMUSP00000005477
Gene: ENSMUSG00000030483
AA Change: K438E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:p450 31 497 4.1e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072438
SMART Domains Protein: ENSMUSP00000072264
Gene: ENSMUSG00000030483

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:p450 31 488 2e-152 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, CYP2B6, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by phenobarbital. The enzyme is known to metabolize some xenobiotics, such as the anti-cancer drugs cyclophosphamide and ifosphamide. Transcript variants for this gene have been described; however, it has not been resolved whether these transcripts are in fact produced by this gene or by a closely related pseudogene, CYP2B7. Both the gene and the pseudogene are located in the middle of a CYP2A pseudogene found in a large cluster of cytochrome P450 genes from the CYP2A, CYP2B and CYP2F subfamilies on chromosome 19q. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd14b A G 9: 106,328,817 (GRCm39) D146G probably benign Het
Abhd6 T A 14: 8,028,282 (GRCm38) D4E probably benign Het
Atp5if1 T C 4: 132,260,685 (GRCm39) D34G probably benign Het
Bcr T C 10: 74,967,404 (GRCm39) F546S probably damaging Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Ccdc141 A T 2: 76,844,739 (GRCm39) W1443R probably damaging Het
Chd7 A G 4: 8,839,589 (GRCm39) D1375G probably damaging Het
Chi3l1 A T 1: 134,115,662 (GRCm39) Q223H probably benign Het
Clcn2 A T 16: 20,531,080 (GRCm39) F260I probably damaging Het
Cpq A T 15: 33,594,381 (GRCm39) D464V probably benign Het
Crygb T C 1: 65,121,300 (GRCm39) D9G probably damaging Het
Cyp46a1 A T 12: 108,324,366 (GRCm39) D381V possibly damaging Het
Dhx40 A C 11: 86,667,582 (GRCm39) probably benign Het
Dnase2b G T 3: 146,292,717 (GRCm39) P152Q probably damaging Het
Duox1 A T 2: 122,175,186 (GRCm39) H1328L probably damaging Het
Ephb6 C T 6: 41,590,293 (GRCm39) A15V probably benign Het
Fam168b A G 1: 34,858,862 (GRCm39) F102L probably benign Het
Fam3b T A 16: 97,277,594 (GRCm39) D128V probably damaging Het
Galnt11 T G 5: 25,469,983 (GRCm39) H527Q possibly damaging Het
Gbp2b A T 3: 142,316,730 (GRCm39) R460S probably benign Het
Hdhd2 A C 18: 77,058,366 (GRCm39) S246R possibly damaging Het
Heatr1 T C 13: 12,415,995 (GRCm39) M189T probably damaging Het
Ift70a1 A T 2: 75,810,251 (GRCm39) C611S probably benign Het
Ino80 A G 2: 119,210,059 (GRCm39) S1411P possibly damaging Het
Jakmip1 A G 5: 37,274,882 (GRCm39) T467A probably benign Het
Kcnh2 A G 5: 24,536,868 (GRCm39) S239P probably benign Het
Lct T A 1: 128,228,299 (GRCm39) T1065S probably damaging Het
Lrrc66 T C 5: 73,787,227 (GRCm39) D41G probably benign Het
Mfsd2b A T 12: 4,921,490 (GRCm39) D26E probably benign Het
Myh1 A T 11: 67,096,607 (GRCm39) M333L probably benign Het
Neurl4 T C 11: 69,798,958 (GRCm39) V855A possibly damaging Het
Nfkb2 T A 19: 46,295,304 (GRCm39) V80D probably damaging Het
Nop9 T C 14: 55,983,438 (GRCm39) S70P possibly damaging Het
Or2t46 A G 11: 58,471,738 (GRCm39) S23G probably benign Het
Pcdhb14 G T 18: 37,582,231 (GRCm39) D446Y probably damaging Het
Pclo C T 5: 14,719,325 (GRCm39) A1154V unknown Het
Pdgfa G T 5: 138,971,977 (GRCm39) Q141K probably damaging Het
Plekhh1 G T 12: 79,122,307 (GRCm39) L1133F probably damaging Het
Pole A T 5: 110,471,488 (GRCm39) N1411Y possibly damaging Het
Primpol A G 8: 47,034,597 (GRCm39) probably benign Het
Psmc5 T G 11: 106,152,787 (GRCm39) V203G probably damaging Het
Ptgdr C T 14: 45,096,181 (GRCm39) C177Y probably damaging Het
Ptgir A T 7: 16,641,220 (GRCm39) I171F probably damaging Het
Ptprg T A 14: 12,154,170 (GRCm38) H630Q probably benign Het
Ptrh2 A G 11: 86,580,907 (GRCm39) T175A possibly damaging Het
Ralgapb A G 2: 158,296,197 (GRCm39) T857A probably damaging Het
Rnf24 A G 2: 131,155,197 (GRCm39) F10S possibly damaging Het
Rreb1 C A 13: 38,114,352 (GRCm39) S570R probably benign Het
Rttn A G 18: 88,995,832 (GRCm39) N205S probably benign Het
Rusc1 T C 3: 88,999,365 (GRCm39) E139G probably benign Het
Scn2a A G 2: 65,594,242 (GRCm39) N1697S probably damaging Het
Serpinb3a T A 1: 106,974,907 (GRCm39) M209L probably damaging Het
Shank3 A G 15: 89,432,888 (GRCm39) D1211G possibly damaging Het
Slc22a12 C A 19: 6,592,514 (GRCm39) R90L possibly damaging Het
Slc6a13 G A 6: 121,313,901 (GRCm39) W548* probably null Het
Srfbp1 T A 18: 52,609,392 (GRCm39) L59* probably null Het
Ss18 A T 18: 14,803,380 (GRCm39) S73T probably damaging Het
Syne1 T C 10: 5,135,508 (GRCm39) K189R probably benign Het
Szt2 G T 4: 118,239,985 (GRCm39) probably benign Het
Tbx1 T A 16: 18,402,937 (GRCm39) H183L probably damaging Het
Thop1 A G 10: 80,915,972 (GRCm39) E385G possibly damaging Het
Tmem168 C A 6: 13,602,849 (GRCm39) M172I possibly damaging Het
Tmem67 A G 4: 12,058,559 (GRCm39) Y513H probably damaging Het
Top1 A G 2: 160,562,921 (GRCm39) D709G probably damaging Het
Tprg1l A C 4: 154,242,890 (GRCm39) S247A probably damaging Het
Trim46 A G 3: 89,143,692 (GRCm39) S602P probably damaging Het
Ttc7b T C 12: 100,466,433 (GRCm39) K60E probably benign Het
Ttn G A 2: 76,714,815 (GRCm39) S8053F unknown Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Usp24 T A 4: 106,234,762 (GRCm39) H956Q probably benign Het
Vcp T C 4: 42,980,828 (GRCm39) T761A probably benign Het
Xpc G A 6: 91,477,956 (GRCm39) T309I possibly damaging Het
Zfp560 C T 9: 20,260,895 (GRCm39) M129I probably benign Het
Zpld2 G A 4: 133,929,978 (GRCm39) T109I probably damaging Het
Other mutations in Cyp2b10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02270:Cyp2b10 APN 7 25,613,362 (GRCm39) missense probably damaging 0.99
IGL02341:Cyp2b10 APN 7 25,610,667 (GRCm39) missense probably benign 0.33
IGL02557:Cyp2b10 APN 7 25,614,306 (GRCm39) missense probably benign
R0038:Cyp2b10 UTSW 7 25,614,287 (GRCm39) missense probably benign 0.21
R0393:Cyp2b10 UTSW 7 25,614,359 (GRCm39) splice site probably benign
R0569:Cyp2b10 UTSW 7 25,597,160 (GRCm39) missense probably damaging 1.00
R1035:Cyp2b10 UTSW 7 25,616,473 (GRCm39) missense probably benign 0.34
R1262:Cyp2b10 UTSW 7 25,614,836 (GRCm39) missense probably benign 0.16
R1282:Cyp2b10 UTSW 7 25,625,505 (GRCm39) missense probably damaging 1.00
R1452:Cyp2b10 UTSW 7 25,624,813 (GRCm39) intron probably benign
R2163:Cyp2b10 UTSW 7 25,624,810 (GRCm39) intron probably benign
R4520:Cyp2b10 UTSW 7 25,610,982 (GRCm39) missense probably benign 0.05
R4831:Cyp2b10 UTSW 7 25,614,921 (GRCm39) nonsense probably null
R5201:Cyp2b10 UTSW 7 25,616,419 (GRCm39) missense probably damaging 1.00
R5330:Cyp2b10 UTSW 7 25,613,414 (GRCm39) nonsense probably null
R5586:Cyp2b10 UTSW 7 25,616,437 (GRCm39) missense probably damaging 1.00
R5964:Cyp2b10 UTSW 7 25,625,648 (GRCm39) missense probably benign 0.28
R6043:Cyp2b10 UTSW 7 25,616,764 (GRCm39) missense probably damaging 0.99
R6470:Cyp2b10 UTSW 7 25,611,081 (GRCm39) missense possibly damaging 0.57
R6991:Cyp2b10 UTSW 7 25,616,780 (GRCm39) missense probably benign 0.05
R7567:Cyp2b10 UTSW 7 25,614,204 (GRCm39) missense probably damaging 1.00
R7847:Cyp2b10 UTSW 7 25,597,185 (GRCm39) missense possibly damaging 0.52
R8131:Cyp2b10 UTSW 7 25,614,242 (GRCm39) nonsense probably null
R8486:Cyp2b10 UTSW 7 25,614,306 (GRCm39) missense probably benign
R8988:Cyp2b10 UTSW 7 25,625,670 (GRCm39) missense probably damaging 1.00
R9286:Cyp2b10 UTSW 7 25,616,391 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTCTGTCCAATGTTTGTCTGT -3'
(R):5'- GGCCCAAGTGAGGATGCTT -3'

Sequencing Primer
(F):5'- GGATATCTGCATCTGTTTCAGTCAGC -3'
(R):5'- CCCAAGTGAGGATGCTTGAATCTC -3'
Posted On 2021-10-11