Mutagenetix > Incidental Mutation

Incidental Mutation 'R8992:Bean1'

684483

Institutional Source

Beutler Lab

Gene Symbol

Bean1

Ensembl Gene

ENSMUSG00000031872

Gene Name

brain expressed, associated with Nedd4, 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8992 (G1)

Quality Score

214.458

Status

Validated

Chromosome

Chromosomal Location

104170442-104219122 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

CT to C at 104182032 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148571 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093245] [ENSMUST00000164076] [ENSMUST00000167633] [ENSMUST00000171018] [ENSMUST00000212979] [ENSMUST00000213077]

AlphaFold

Q9EQG5

Predicted Effect

probably benign
Transcript: ENSMUST00000093245

SMART Domains

Protein: ENSMUSP00000090931
Gene: ENSMUSG00000031872

Domain	Start	End	E-Value	Type
transmembrane domain	38	60	N/A	INTRINSIC
low complexity region	70	90	N/A	INTRINSIC
low complexity region	217	232	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153288

Predicted Effect

probably benign
Transcript: ENSMUST00000164076

SMART Domains

Protein: ENSMUSP00000132056
Gene: ENSMUSG00000031872

Domain	Start	End	E-Value	Type
low complexity region	156	171	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167633

SMART Domains

Protein: ENSMUSP00000131530
Gene: ENSMUSG00000031872

Domain	Start	End	E-Value	Type
transmembrane domain	38	60	N/A	INTRINSIC
low complexity region	70	90	N/A	INTRINSIC
low complexity region	217	232	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000171018

SMART Domains

Protein: ENSMUSP00000129403
Gene: ENSMUSG00000031872

Domain	Start	End	E-Value	Type
transmembrane domain	72	94	N/A	INTRINSIC
low complexity region	104	124	N/A	INTRINSIC
low complexity region	288	303	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000212979

Predicted Effect

probably benign
Transcript: ENSMUST00000213077

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of several proteins that interact with NEDD4, a member of a family of ubiquitin-protein ligases. These proteins have PY motifs in common that bind to the WW domains of NEDD4. NEDD4 is developmentally regulated, and is highly expressed in embryonic tissues. Mutations in this gene (i.e., intronic insertions of >100 copies of pentanucleotide repeats including a (TGGAA)n sequence) are associated with spinocerebellar ataxia type 31. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null targeted allele are viable and fertile and exhibit no apparent abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd14b	A	G	9: 106,451,618	D146G	probably benign	Het
Abhd6	T	A	14: 8,028,282	D4E	probably benign	Het
Atpif1	T	C	4: 132,533,374	D34G	probably benign	Het
Bcr	T	C	10: 75,131,572	F546S	probably damaging	Het
Ccdc141	A	T	2: 77,014,395	W1443R	probably damaging	Het
Chd7	A	G	4: 8,839,589	D1375G	probably damaging	Het
Chil1	A	T	1: 134,187,924	Q223H	probably benign	Het
Clcn2	A	T	16: 20,712,330	F260I	probably damaging	Het
Cpq	A	T	15: 33,594,235	D464V	probably benign	Het
Crygb	T	C	1: 65,082,141	D9G	probably damaging	Het
Cyp2b10	A	G	7: 25,925,390	K438E	unknown	Het
Cyp46a1	A	T	12: 108,358,107	D381V	possibly damaging	Het
Dhx40	A	C	11: 86,776,756		probably benign	Het
Dnase2b	G	T	3: 146,586,962	P152Q	probably damaging	Het
Duox1	A	T	2: 122,344,705	H1328L	probably damaging	Het
Ephb6	C	T	6: 41,613,359	A15V	probably benign	Het
Fam168b	A	G	1: 34,819,781	F102L	probably benign	Het
Fam3b	T	A	16: 97,476,394	D128V	probably damaging	Het
Galnt11	T	G	5: 25,264,985	H527Q	possibly damaging	Het
Gbp2b	A	T	3: 142,610,969	R460S	probably benign	Het
Gm7534	G	A	4: 134,202,667	T109I	probably damaging	Het
Hdhd2	A	C	18: 76,970,670	S246R	possibly damaging	Het
Heatr1	T	C	13: 12,401,114	M189T	probably damaging	Het
Ino80	A	G	2: 119,379,578	S1411P	possibly damaging	Het
Jakmip1	A	G	5: 37,117,538	T467A	probably benign	Het
Kcnh2	A	G	5: 24,331,870	S239P	probably benign	Het
Lct	T	A	1: 128,300,562	T1065S	probably damaging	Het
Lrrc66	T	C	5: 73,629,884	D41G	probably benign	Het
Mfsd2b	A	T	12: 4,871,490	D26E	probably benign	Het
Myh1	A	T	11: 67,205,781	M333L	probably benign	Het
Neurl4	T	C	11: 69,908,132	V855A	possibly damaging	Het
Nfkb2	T	A	19: 46,306,865	V80D	probably damaging	Het
Nop9	T	C	14: 55,745,981	S70P	possibly damaging	Het
Olfr325	A	G	11: 58,580,912	S23G	probably benign	Het
Pcdhb14	G	T	18: 37,449,178	D446Y	probably damaging	Het
Pclo	C	T	5: 14,669,311	A1154V	unknown	Het
Pdgfa	G	T	5: 138,986,222	Q141K	probably damaging	Het
Plekhh1	G	T	12: 79,075,533	L1133F	probably damaging	Het
Pole	A	T	5: 110,323,622	N1411Y	possibly damaging	Het
Primpol	A	G	8: 46,581,562		probably benign	Het
Psmc5	T	G	11: 106,261,961	V203G	probably damaging	Het
Ptgdr	C	T	14: 44,858,724	C177Y	probably damaging	Het
Ptgir	A	T	7: 16,907,295	I171F	probably damaging	Het
Ptprg	T	A	14: 12,154,170	H630Q	probably benign	Het
Ptrh2	A	G	11: 86,690,081	T175A	possibly damaging	Het
Ralgapb	A	G	2: 158,454,277	T857A	probably damaging	Het
Rnf24	A	G	2: 131,313,277	F10S	possibly damaging	Het
Rreb1	C	A	13: 37,930,376	S570R	probably benign	Het
Rttn	A	G	18: 88,977,708	N205S	probably benign	Het
Rusc1	T	C	3: 89,092,058	E139G	probably benign	Het
Scn2a	A	G	2: 65,763,898	N1697S	probably damaging	Het
Serpinb3a	T	A	1: 107,047,177	M209L	probably damaging	Het
Shank3	A	G	15: 89,548,685	D1211G	possibly damaging	Het
Slc22a12	C	A	19: 6,542,484	R90L	possibly damaging	Het
Slc6a13	G	A	6: 121,336,942	W548*	probably null	Het
Srfbp1	T	A	18: 52,476,320	L59*	probably null	Het
Ss18	A	T	18: 14,670,323	S73T	probably damaging	Het
Syne1	T	C	10: 5,185,508	K189R	probably benign	Het
Szt2	G	T	4: 118,382,788		probably benign	Het
Tbx1	T	A	16: 18,584,187	H183L	probably damaging	Het
Thop1	A	G	10: 81,080,138	E385G	possibly damaging	Het
Tmem168	C	A	6: 13,602,850	M172I	possibly damaging	Het
Tmem67	A	G	4: 12,058,559	Y513H	probably damaging	Het
Top1	A	G	2: 160,721,001	D709G	probably damaging	Het
Tprgl	A	C	4: 154,158,433	S247A	probably damaging	Het
Trim46	A	G	3: 89,236,385	S602P	probably damaging	Het
Ttc30a1	A	T	2: 75,979,907	C611S	probably benign	Het
Ttc7b	T	C	12: 100,500,174	K60E	probably benign	Het
Ttn	G	A	2: 76,884,471	S8053F	unknown	Het
Tyw1	G	A	5: 130,269,224	R202Q	probably damaging	Het
Usp24	T	A	4: 106,377,565	H956Q	probably benign	Het
Vcp	T	C	4: 42,980,828	T761A	probably benign	Het
Xpc	G	A	6: 91,500,974	T309I	possibly damaging	Het
Zfp560	C	T	9: 20,349,599	M129I	probably benign	Het

Other mutations in Bean1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02016:Bean1	APN	8	104210918	missense	possibly damaging	0.90
R0135:Bean1	UTSW	8	104217175	missense	probably damaging	1.00
R0490:Bean1	UTSW	8	104215028	missense	possibly damaging	0.76
R1319:Bean1	UTSW	8	104217224	missense	probably benign
R1920:Bean1	UTSW	8	104211110	missense	possibly damaging	0.92
R2513:Bean1	UTSW	8	104182011	missense	probably benign	0.04
R3980:Bean1	UTSW	8	104211098	missense	possibly damaging	0.92
R4209:Bean1	UTSW	8	104213934	start codon destroyed	probably null	0.04
R4369:Bean1	UTSW	8	104217110	missense	probably damaging	1.00
R4516:Bean1	UTSW	8	104215154	missense	probably damaging	1.00
R4542:Bean1	UTSW	8	104210959	missense	probably damaging	1.00
R4663:Bean1	UTSW	8	104211167	missense	probably damaging	1.00
R4962:Bean1	UTSW	8	104216974	missense	probably damaging	1.00
R5221:Bean1	UTSW	8	104215152	missense	probably damaging	1.00
R6288:Bean1	UTSW	8	104210990	missense	probably damaging	1.00
R6588:Bean1	UTSW	8	104182032	frame shift	probably null
R6615:Bean1	UTSW	8	104182032	frame shift	probably null
R6994:Bean1	UTSW	8	104182032	frame shift	probably null
R7359:Bean1	UTSW	8	104182032	frame shift	probably null
R7451:Bean1	UTSW	8	104213996	missense	probably benign	0.01
R7454:Bean1	UTSW	8	104211026	missense	probably damaging	1.00
R7473:Bean1	UTSW	8	104182032	frame shift	probably null
R7537:Bean1	UTSW	8	104182032	frame shift	probably null
R7826:Bean1	UTSW	8	104182032	frame shift	probably null
R8034:Bean1	UTSW	8	104182032	frame shift	probably null
R8418:Bean1	UTSW	8	104182032	frame shift	probably null
R8789:Bean1	UTSW	8	104182032	frame shift	probably null
R8885:Bean1	UTSW	8	104182120	critical splice donor site	probably null
R8888:Bean1	UTSW	8	104182032	frame shift	probably null
R8892:Bean1	UTSW	8	104216978	missense	probably damaging	1.00
R8896:Bean1	UTSW	8	104182032	frame shift	probably null
R9015:Bean1	UTSW	8	104182032	frame shift	probably null
R9113:Bean1	UTSW	8	104213925	missense	probably benign	0.00
R9122:Bean1	UTSW	8	104182032	frame shift	probably null
R9135:Bean1	UTSW	8	104182032	frame shift	probably null
R9151:Bean1	UTSW	8	104182032	frame shift	probably null
R9255:Bean1	UTSW	8	104182032	frame shift	probably null
R9340:Bean1	UTSW	8	104182107	missense	probably damaging	0.99
R9363:Bean1	UTSW	8	104182032	frame shift	probably null
R9417:Bean1	UTSW	8	104182032	frame shift	probably null
R9537:Bean1	UTSW	8	104182032	frame shift	probably null
R9566:Bean1	UTSW	8	104182032	frame shift	probably null
R9731:Bean1	UTSW	8	104182032	frame shift	probably null
RF054:Bean1	UTSW	8	104182032	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- ACTGTGACCTCAATACCCCATG -3'
(R):5'- TCCACACTAGCCTTGGTCAG -3'

Sequencing Primer
(F):5'- GACCTCAATACCCCATGTGATATTC -3'
(R):5'- CTTGGTCAGGCTCAGTGC -3'

Posted On

2021-10-11