Mutagenetix > Incidental Mutation

Incidental Mutation 'R8992:Ptprg'

684501

Institutional Source

Beutler Lab

Gene Symbol

Ptprg

Ensembl Gene

ENSMUSG00000021745

Gene Name

protein tyrosine phosphatase, receptor type, G

Synonyms

5430405N12Rik, RPTPgamma

MMRRC Submission

068823-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8992 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

11553532-12242041 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 12154170 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 630 (H630Q)

Ref Sequence

ENSEMBL: ENSMUSP00000022264 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022264] [ENSMUST00000142917] [ENSMUST00000226099]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000022264
AA Change: H630Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000022264
Gene: ENSMUSG00000021745
AA Change: H630Q

Domain	Start	End	E-Value	Type
Carb_anhydrase	60	321	6.38e-109	SMART
FN3	347	433	5.4e-7	SMART
low complexity region	474	484	N/A	INTRINSIC
low complexity region	515	525	N/A	INTRINSIC
coiled coil region	581	617	N/A	INTRINSIC
transmembrane domain	734	756	N/A	INTRINSIC
PTPc	844	1118	1.76e-136	SMART
PTPc	1146	1409	1.32e-85	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000142917

SMART Domains

Protein: ENSMUSP00000121268
Gene: ENSMUSG00000021745

Domain	Start	End	E-Value	Type
Carb_anhydrase	60	260	1.6e-50	SMART

Predicted Effect

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this PTP contains a carbonic anhydrase-like (CAH) domain, which is also found in the extracellular region of PTPRBETA/ZETA. This gene is located in a chromosomal region that is frequently deleted in renal cell carcinoma and lung carcinoma, thus is thought to be a candidate tumor suppressor gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overtly normal but exhibit minor behavioral changes including specific motor deficits, reduced latency to react in the tail flick test, enhanced sensory processing for acoustic stimuli, and reduced performance with cued fear conditioning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd14b	A	G	9: 106,451,618	D146G	probably benign	Het
Abhd6	T	A	14: 8,028,282	D4E	probably benign	Het
Atpif1	T	C	4: 132,533,374	D34G	probably benign	Het
Bcr	T	C	10: 75,131,572	F546S	probably damaging	Het
Bean1	CT	C	8: 104,182,032		probably null	Het
Ccdc141	A	T	2: 77,014,395	W1443R	probably damaging	Het
Chd7	A	G	4: 8,839,589	D1375G	probably damaging	Het
Chil1	A	T	1: 134,187,924	Q223H	probably benign	Het
Clcn2	A	T	16: 20,712,330	F260I	probably damaging	Het
Cpq	A	T	15: 33,594,235	D464V	probably benign	Het
Crygb	T	C	1: 65,082,141	D9G	probably damaging	Het
Cyp2b10	A	G	7: 25,925,390	K438E	unknown	Het
Cyp46a1	A	T	12: 108,358,107	D381V	possibly damaging	Het
Dhx40	A	C	11: 86,776,756		probably benign	Het
Dnase2b	G	T	3: 146,586,962	P152Q	probably damaging	Het
Duox1	A	T	2: 122,344,705	H1328L	probably damaging	Het
Ephb6	C	T	6: 41,613,359	A15V	probably benign	Het
Fam168b	A	G	1: 34,819,781	F102L	probably benign	Het
Fam3b	T	A	16: 97,476,394	D128V	probably damaging	Het
Galnt11	T	G	5: 25,264,985	H527Q	possibly damaging	Het
Gbp2b	A	T	3: 142,610,969	R460S	probably benign	Het
Gm7534	G	A	4: 134,202,667	T109I	probably damaging	Het
Hdhd2	A	C	18: 76,970,670	S246R	possibly damaging	Het
Heatr1	T	C	13: 12,401,114	M189T	probably damaging	Het
Ino80	A	G	2: 119,379,578	S1411P	possibly damaging	Het
Jakmip1	A	G	5: 37,117,538	T467A	probably benign	Het
Kcnh2	A	G	5: 24,331,870	S239P	probably benign	Het
Lct	T	A	1: 128,300,562	T1065S	probably damaging	Het
Lrrc66	T	C	5: 73,629,884	D41G	probably benign	Het
Mfsd2b	A	T	12: 4,871,490	D26E	probably benign	Het
Myh1	A	T	11: 67,205,781	M333L	probably benign	Het
Neurl4	T	C	11: 69,908,132	V855A	possibly damaging	Het
Nfkb2	T	A	19: 46,306,865	V80D	probably damaging	Het
Nop9	T	C	14: 55,745,981	S70P	possibly damaging	Het
Olfr325	A	G	11: 58,580,912	S23G	probably benign	Het
Pcdhb14	G	T	18: 37,449,178	D446Y	probably damaging	Het
Pclo	C	T	5: 14,669,311	A1154V	unknown	Het
Pdgfa	G	T	5: 138,986,222	Q141K	probably damaging	Het
Plekhh1	G	T	12: 79,075,533	L1133F	probably damaging	Het
Pole	A	T	5: 110,323,622	N1411Y	possibly damaging	Het
Primpol	A	G	8: 46,581,562		probably benign	Het
Psmc5	T	G	11: 106,261,961	V203G	probably damaging	Het
Ptgdr	C	T	14: 44,858,724	C177Y	probably damaging	Het
Ptgir	A	T	7: 16,907,295	I171F	probably damaging	Het
Ptrh2	A	G	11: 86,690,081	T175A	possibly damaging	Het
Ralgapb	A	G	2: 158,454,277	T857A	probably damaging	Het
Rnf24	A	G	2: 131,313,277	F10S	possibly damaging	Het
Rreb1	C	A	13: 37,930,376	S570R	probably benign	Het
Rttn	A	G	18: 88,977,708	N205S	probably benign	Het
Rusc1	T	C	3: 89,092,058	E139G	probably benign	Het
Scn2a	A	G	2: 65,763,898	N1697S	probably damaging	Het
Serpinb3a	T	A	1: 107,047,177	M209L	probably damaging	Het
Shank3	A	G	15: 89,548,685	D1211G	possibly damaging	Het
Slc22a12	C	A	19: 6,542,484	R90L	possibly damaging	Het
Slc6a13	G	A	6: 121,336,942	W548*	probably null	Het
Srfbp1	T	A	18: 52,476,320	L59*	probably null	Het
Ss18	A	T	18: 14,670,323	S73T	probably damaging	Het
Syne1	T	C	10: 5,185,508	K189R	probably benign	Het
Szt2	G	T	4: 118,382,788		probably benign	Het
Tbx1	T	A	16: 18,584,187	H183L	probably damaging	Het
Thop1	A	G	10: 81,080,138	E385G	possibly damaging	Het
Tmem168	C	A	6: 13,602,850	M172I	possibly damaging	Het
Tmem67	A	G	4: 12,058,559	Y513H	probably damaging	Het
Top1	A	G	2: 160,721,001	D709G	probably damaging	Het
Tprgl	A	C	4: 154,158,433	S247A	probably damaging	Het
Trim46	A	G	3: 89,236,385	S602P	probably damaging	Het
Ttc30a1	A	T	2: 75,979,907	C611S	probably benign	Het
Ttc7b	T	C	12: 100,500,174	K60E	probably benign	Het
Ttn	G	A	2: 76,884,471	S8053F	unknown	Het
Tyw1	G	A	5: 130,269,224	R202Q	probably damaging	Het
Usp24	T	A	4: 106,377,565	H956Q	probably benign	Het
Vcp	T	C	4: 42,980,828	T761A	probably benign	Het
Xpc	G	A	6: 91,500,974	T309I	possibly damaging	Het
Zfp560	C	T	9: 20,349,599	M129I	probably benign	Het

Other mutations in Ptprg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Ptprg	APN	14	12215992	missense	probably damaging	1.00
IGL00484:Ptprg	APN	14	12215220	missense	probably damaging	0.99
IGL00847:Ptprg	APN	14	12215265	missense	probably damaging	1.00
IGL01089:Ptprg	APN	14	12215286	missense	probably damaging	0.97
IGL01382:Ptprg	APN	14	12237797	missense	probably benign	0.16
IGL01470:Ptprg	APN	14	12213702	nonsense	probably null
IGL01762:Ptprg	APN	14	12037386	missense	probably benign	0.00
IGL01886:Ptprg	APN	14	12179280	missense	probably benign	0.22
IGL01963:Ptprg	APN	14	12220661	missense	probably damaging	1.00
IGL02015:Ptprg	APN	14	12237782	missense	possibly damaging	0.46
IGL02086:Ptprg	APN	14	12110080	nonsense	probably null
IGL02197:Ptprg	APN	14	12220613	missense	probably damaging	0.98
IGL02341:Ptprg	APN	14	12154360	missense	probably benign	0.00
IGL02732:Ptprg	APN	14	12225617	critical splice donor site	probably null
IGL03011:Ptprg	APN	14	12219029	missense	probably damaging	1.00
IGL03261:Ptprg	APN	14	12225552	missense	probably damaging	0.99
R0038:Ptprg	UTSW	14	12213710	missense	probably damaging	1.00
R0383:Ptprg	UTSW	14	12219024	missense	possibly damaging	0.93
R0433:Ptprg	UTSW	14	12220620	missense	probably damaging	1.00
R0488:Ptprg	UTSW	14	12220653	missense	probably damaging	1.00
R0503:Ptprg	UTSW	14	12237138	missense	possibly damaging	0.89
R0520:Ptprg	UTSW	14	12199783	missense	possibly damaging	0.92
R0570:Ptprg	UTSW	14	12215896	missense	probably damaging	1.00
R0606:Ptprg	UTSW	14	12154131	missense	probably benign
R1086:Ptprg	UTSW	14	11952706	splice site	probably benign
R1468:Ptprg	UTSW	14	12190767	missense	probably benign	0.02
R1468:Ptprg	UTSW	14	12190767	missense	probably benign	0.02
R1519:Ptprg	UTSW	14	12220596	missense	probably damaging	1.00
R1662:Ptprg	UTSW	14	12207357	missense	probably damaging	1.00
R1714:Ptprg	UTSW	14	12213697	missense	probably damaging	1.00
R1716:Ptprg	UTSW	14	12154360	missense	probably benign	0.00
R1797:Ptprg	UTSW	14	12199743	missense	probably damaging	1.00
R1803:Ptprg	UTSW	14	12091410	splice site	probably null
R2104:Ptprg	UTSW	14	11952897	critical splice donor site	probably null
R2125:Ptprg	UTSW	14	12179283	missense	possibly damaging	0.74
R2126:Ptprg	UTSW	14	12154355	missense	probably benign
R2133:Ptprg	UTSW	14	12211637	missense	probably damaging	1.00
R2471:Ptprg	UTSW	14	12210327	missense	probably damaging	1.00
R2571:Ptprg	UTSW	14	12122135	missense	probably benign
R3821:Ptprg	UTSW	14	12226375	missense	probably benign	0.00
R4196:Ptprg	UTSW	14	12122002	missense	possibly damaging	0.51
R4392:Ptprg	UTSW	14	12142467	missense	possibly damaging	0.80
R4665:Ptprg	UTSW	14	12215288	missense	possibly damaging	0.90
R4730:Ptprg	UTSW	14	12213713	missense	probably damaging	1.00
R4737:Ptprg	UTSW	14	12226314	missense	probably damaging	1.00
R4764:Ptprg	UTSW	14	12122068	missense	probably benign	0.01
R4801:Ptprg	UTSW	14	11554233	utr 5 prime	probably benign
R4825:Ptprg	UTSW	14	12220654	missense	probably damaging	1.00
R4960:Ptprg	UTSW	14	12237837	missense	probably benign	0.07
R4972:Ptprg	UTSW	14	12226427	missense	possibly damaging	0.94
R4980:Ptprg	UTSW	14	12154421	missense	probably benign	0.16
R5004:Ptprg	UTSW	14	12220667	missense	probably damaging	1.00
R5058:Ptprg	UTSW	14	12037387	missense	possibly damaging	0.82
R5182:Ptprg	UTSW	14	12154174	missense	probably benign
R5258:Ptprg	UTSW	14	12142431	missense	probably benign	0.11
R5338:Ptprg	UTSW	14	12154111	missense	probably benign
R5353:Ptprg	UTSW	14	11554235	utr 5 prime	probably benign
R5373:Ptprg	UTSW	14	12213665	missense	probably benign	0.00
R5387:Ptprg	UTSW	14	12153873	missense	probably damaging	1.00
R5616:Ptprg	UTSW	14	12122120	missense	probably benign
R5623:Ptprg	UTSW	14	12153857	missense	probably damaging	1.00
R5976:Ptprg	UTSW	14	12211625	missense	probably damaging	0.96
R6027:Ptprg	UTSW	14	12220613	missense	possibly damaging	0.87
R6091:Ptprg	UTSW	14	12215979	missense	probably damaging	1.00
R6184:Ptprg	UTSW	14	12153943	missense	probably benign	0.00
R6234:Ptprg	UTSW	14	12213747	missense	probably damaging	1.00
R6318:Ptprg	UTSW	14	12237118	missense	probably damaging	1.00
R6324:Ptprg	UTSW	14	12226314	missense	probably damaging	1.00
R6334:Ptprg	UTSW	14	12166832	missense	probably damaging	1.00
R6646:Ptprg	UTSW	14	11962714	missense	probably damaging	1.00
R6647:Ptprg	UTSW	14	11962714	missense	probably damaging	1.00
R6992:Ptprg	UTSW	14	11962602	missense	probably damaging	1.00
R7088:Ptprg	UTSW	14	12207365	missense	probably damaging	1.00
R7250:Ptprg	UTSW	14	12166767	missense	probably benign	0.18
R7342:Ptprg	UTSW	14	12237151	missense	possibly damaging	0.90
R7358:Ptprg	UTSW	14	12154198	missense	possibly damaging	0.59
R7410:Ptprg	UTSW	14	11962657	missense	probably damaging	1.00
R7448:Ptprg	UTSW	14	12142461	missense	probably benign	0.12
R7514:Ptprg	UTSW	14	12179342	missense	possibly damaging	0.86
R7523:Ptprg	UTSW	14	12237130	missense	probably damaging	0.97
R7672:Ptprg	UTSW	14	12211668	missense	probably benign	0.04
R7709:Ptprg	UTSW	14	12226452	missense	probably damaging	1.00
R7720:Ptprg	UTSW	14	12211703	missense	probably benign	0.31
R8860:Ptprg	UTSW	14	12213685	missense	probably damaging	1.00
R9054:Ptprg	UTSW	14	12213638	missense	possibly damaging	0.58
R9587:Ptprg	UTSW	14	12215992	missense	probably damaging	1.00
R9621:Ptprg	UTSW	14	12237809	missense	probably benign
R9625:Ptprg	UTSW	14	12152027	missense	probably damaging	1.00
R9773:Ptprg	UTSW	14	12199806	missense	probably damaging	0.97
X0020:Ptprg	UTSW	14	12110070	frame shift	probably null
X0027:Ptprg	UTSW	14	12110070	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AGGACAGTTCTTGCCACCAC -3'
(R):5'- CTATCCTCAGAAAATCGGTCCC -3'

Sequencing Primer
(F):5'- AGTTCTTGCCACCACCGAGG -3'
(R):5'- CCCTCGGGACATAGGCTTTTTAG -3'

Posted On

2021-10-11