Incidental Mutation 'R8992:Rttn'
ID 684513
Institutional Source Beutler Lab
Gene Symbol Rttn
Ensembl Gene ENSMUSG00000023066
Gene Name rotatin
Synonyms C530033I08Rik, 4921538A15Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_175542.3; MGI:2179288
Essential gene? Essential (E-score: 1.000) question?
Stock # R8992 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 88971790-89131013 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 88977708 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 205 (N205S)
Ref Sequence ENSEMBL: ENSMUSP00000023828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023828]
AlphaFold Q8R4Y8
Predicted Effect probably benign
Transcript: ENSMUST00000023828
AA Change: N205S

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023828
Gene: ENSMUSG00000023066
AA Change: N205S

DomainStartEndE-ValueType
Pfam:RTTN_N 16 112 1.2e-36 PFAM
low complexity region 188 199 N/A INTRINSIC
Blast:ARM 216 261 9e-18 BLAST
low complexity region 302 319 N/A INTRINSIC
low complexity region 335 341 N/A INTRINSIC
SCOP:d1gw5a_ 515 952 9e-3 SMART
Blast:ARM 863 910 4e-8 BLAST
low complexity region 972 985 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1213 1222 N/A INTRINSIC
low complexity region 1680 1698 N/A INTRINSIC
low complexity region 1861 1879 N/A INTRINSIC
Blast:ARM 2088 2129 1e-10 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype Strain: 2674124
Lethality: E9-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein whose specific function is unknown. Absence of the orthologous protein in mouse results in embryonic lethality with deficient axial rotation, abnormal differentiation of the neural tube, and randomized looping of the heart tube during development. In human, mutations in this gene are associated with polymicrogyria with seizures. In human fibroblasts this protein localizes at the ciliary basal bodies. Given the intracellular localization of this protein and the phenotypic effects of mutations, this gene is suspected of playing a role in the maintenance of normal ciliary structure which in turn effects the developmental process of left-right organ specification, axial rotation, and perhaps notochord development. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for an insertional mutation exhibit embryonic lethality and neurulation defects resulting in the arrest of gastrulation movements and abnormal left-right specification in the heart. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted(2) Gene trapped(12) Transgenic(1)
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd14b A G 9: 106,451,618 D146G probably benign Het
Abhd6 T A 14: 8,028,282 D4E probably benign Het
Atpif1 T C 4: 132,533,374 D34G probably benign Het
Bcr T C 10: 75,131,572 F546S probably damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Ccdc141 A T 2: 77,014,395 W1443R probably damaging Het
Chd7 A G 4: 8,839,589 D1375G probably damaging Het
Chil1 A T 1: 134,187,924 Q223H probably benign Het
Clcn2 A T 16: 20,712,330 F260I probably damaging Het
Cpq A T 15: 33,594,235 D464V probably benign Het
Crygb T C 1: 65,082,141 D9G probably damaging Het
Cyp2b10 A G 7: 25,925,390 K438E unknown Het
Cyp46a1 A T 12: 108,358,107 D381V possibly damaging Het
Dhx40 A C 11: 86,776,756 probably benign Het
Dnase2b G T 3: 146,586,962 P152Q probably damaging Het
Duox1 A T 2: 122,344,705 H1328L probably damaging Het
Ephb6 C T 6: 41,613,359 A15V probably benign Het
Fam168b A G 1: 34,819,781 F102L probably benign Het
Fam3b T A 16: 97,476,394 D128V probably damaging Het
Galnt11 T G 5: 25,264,985 H527Q possibly damaging Het
Gbp2b A T 3: 142,610,969 R460S probably benign Het
Gm7534 G A 4: 134,202,667 T109I probably damaging Het
Hdhd2 A C 18: 76,970,670 S246R possibly damaging Het
Heatr1 T C 13: 12,401,114 M189T probably damaging Het
Ino80 A G 2: 119,379,578 S1411P possibly damaging Het
Jakmip1 A G 5: 37,117,538 T467A probably benign Het
Kcnh2 A G 5: 24,331,870 S239P probably benign Het
Lct T A 1: 128,300,562 T1065S probably damaging Het
Lrrc66 T C 5: 73,629,884 D41G probably benign Het
Mfsd2b A T 12: 4,871,490 D26E probably benign Het
Myh1 A T 11: 67,205,781 M333L probably benign Het
Neurl4 T C 11: 69,908,132 V855A possibly damaging Het
Nfkb2 T A 19: 46,306,865 V80D probably damaging Het
Nop9 T C 14: 55,745,981 S70P possibly damaging Het
Olfr325 A G 11: 58,580,912 S23G probably benign Het
Pcdhb14 G T 18: 37,449,178 D446Y probably damaging Het
Pclo C T 5: 14,669,311 A1154V unknown Het
Pdgfa G T 5: 138,986,222 Q141K probably damaging Het
Plekhh1 G T 12: 79,075,533 L1133F probably damaging Het
Pole A T 5: 110,323,622 N1411Y possibly damaging Het
Primpol A G 8: 46,581,562 probably benign Het
Psmc5 T G 11: 106,261,961 V203G probably damaging Het
Ptgdr C T 14: 44,858,724 C177Y probably damaging Het
Ptgir A T 7: 16,907,295 I171F probably damaging Het
Ptprg T A 14: 12,154,170 H630Q probably benign Het
Ptrh2 A G 11: 86,690,081 T175A possibly damaging Het
Ralgapb A G 2: 158,454,277 T857A probably damaging Het
Rnf24 A G 2: 131,313,277 F10S possibly damaging Het
Rreb1 C A 13: 37,930,376 S570R probably benign Het
Rusc1 T C 3: 89,092,058 E139G probably benign Het
Scn2a A G 2: 65,763,898 N1697S probably damaging Het
Serpinb3a T A 1: 107,047,177 M209L probably damaging Het
Shank3 A G 15: 89,548,685 D1211G possibly damaging Het
Slc22a12 C A 19: 6,542,484 R90L possibly damaging Het
Slc6a13 G A 6: 121,336,942 W548* probably null Het
Srfbp1 T A 18: 52,476,320 L59* probably null Het
Ss18 A T 18: 14,670,323 S73T probably damaging Het
Syne1 T C 10: 5,185,508 K189R probably benign Het
Szt2 G T 4: 118,382,788 probably benign Het
Tbx1 T A 16: 18,584,187 H183L probably damaging Het
Thop1 A G 10: 81,080,138 E385G possibly damaging Het
Tmem168 C A 6: 13,602,850 M172I possibly damaging Het
Tmem67 A G 4: 12,058,559 Y513H probably damaging Het
Top1 A G 2: 160,721,001 D709G probably damaging Het
Tprgl A C 4: 154,158,433 S247A probably damaging Het
Trim46 A G 3: 89,236,385 S602P probably damaging Het
Ttc30a1 A T 2: 75,979,907 C611S probably benign Het
Ttc7b T C 12: 100,500,174 K60E probably benign Het
Ttn G A 2: 76,884,471 S8053F unknown Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Usp24 T A 4: 106,377,565 H956Q probably benign Het
Vcp T C 4: 42,980,828 T761A probably benign Het
Xpc G A 6: 91,500,974 T309I possibly damaging Het
Zfp560 C T 9: 20,349,599 M129I probably benign Het
Other mutations in Rttn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Rttn APN 18 88974340 missense probably benign 0.00
IGL00788:Rttn APN 18 88972509 missense probably benign 0.00
IGL00929:Rttn APN 18 89028935 missense probably damaging 1.00
IGL01392:Rttn APN 18 88995613 missense probably benign 0.03
IGL01395:Rttn APN 18 89129770 missense possibly damaging 0.89
IGL01701:Rttn APN 18 89064215 missense probably damaging 1.00
IGL02136:Rttn APN 18 89046128 missense possibly damaging 0.87
IGL02151:Rttn APN 18 89020205 missense probably damaging 1.00
IGL02165:Rttn APN 18 89043041 missense probably benign
IGL02228:Rttn APN 18 89042231 missense probably damaging 1.00
IGL02276:Rttn APN 18 89048454 missense possibly damaging 0.94
IGL02612:Rttn APN 18 88973626 missense probably damaging 1.00
IGL02645:Rttn APN 18 89110686 missense probably benign 0.04
IGL02716:Rttn APN 18 89048417 missense possibly damaging 0.77
IGL02820:Rttn APN 18 89028998 missense probably damaging 1.00
IGL02961:Rttn APN 18 89053573 missense probably damaging 1.00
IGL02973:Rttn APN 18 88972494 missense probably damaging 1.00
IGL03027:Rttn APN 18 88979690 missense probably damaging 1.00
IGL03082:Rttn APN 18 88983948 missense probably damaging 1.00
IGL03121:Rttn APN 18 88975751 missense probably damaging 1.00
IGL03135:Rttn APN 18 89015150 missense probably damaging 1.00
IGL03328:Rttn APN 18 89043028 missense probably benign 0.19
Fascisti UTSW 18 89009460 splice site probably benign
marcher UTSW 18 89037946 missense probably damaging 0.99
militaristi UTSW 18 89010916 missense probably damaging 1.00
Thoughtless UTSW 18 89014611 missense probably damaging 1.00
twister UTSW 18 89046162 critical splice donor site probably null
Vermiculus UTSW 18 89090433 missense probably benign
R0062:Rttn UTSW 18 89010966 critical splice donor site probably null
R0062:Rttn UTSW 18 89010966 critical splice donor site probably null
R0310:Rttn UTSW 18 89009460 splice site probably benign
R0330:Rttn UTSW 18 88986080 splice site probably null
R0363:Rttn UTSW 18 89010955 missense probably damaging 1.00
R0485:Rttn UTSW 18 89090419 splice site probably benign
R0590:Rttn UTSW 18 88979635 missense probably damaging 1.00
R0601:Rttn UTSW 18 89042966 missense probably benign 0.00
R0604:Rttn UTSW 18 88977758 missense probably damaging 1.00
R0631:Rttn UTSW 18 88989546 missense probably benign 0.00
R0882:Rttn UTSW 18 88973689 nonsense probably null
R0885:Rttn UTSW 18 88983810 missense probably benign 0.03
R0900:Rttn UTSW 18 89101691 missense probably benign 0.13
R1077:Rttn UTSW 18 89064249 missense probably damaging 1.00
R1444:Rttn UTSW 18 89042867 missense probably benign 0.04
R1460:Rttn UTSW 18 89109357 splice site probably benign
R1517:Rttn UTSW 18 89113350 missense probably benign 0.01
R1630:Rttn UTSW 18 89042954 missense probably benign 0.02
R1632:Rttn UTSW 18 89009336 missense probably benign 0.18
R1722:Rttn UTSW 18 88973531 missense probably benign 0.34
R1755:Rttn UTSW 18 89009317 missense probably damaging 1.00
R1881:Rttn UTSW 18 89015212 missense probably damaging 0.96
R1971:Rttn UTSW 18 89090433 missense probably benign
R2035:Rttn UTSW 18 89020216 missense probably damaging 1.00
R2109:Rttn UTSW 18 88986073 missense possibly damaging 0.93
R2191:Rttn UTSW 18 89095648 critical splice donor site probably null
R2201:Rttn UTSW 18 89010943 missense possibly damaging 0.88
R2266:Rttn UTSW 18 89064171 missense probably benign 0.05
R3014:Rttn UTSW 18 89014620 missense probably damaging 1.00
R3052:Rttn UTSW 18 89015246 splice site probably benign
R3427:Rttn UTSW 18 89095651 splice site probably null
R3431:Rttn UTSW 18 89095571 missense probably benign 0.04
R3786:Rttn UTSW 18 89037894 missense probably benign 0.00
R3803:Rttn UTSW 18 88977707 missense probably damaging 0.96
R3980:Rttn UTSW 18 89017275 missense probably benign 0.12
R4035:Rttn UTSW 18 88995653 missense probably benign 0.03
R4170:Rttn UTSW 18 88975723 missense probably damaging 1.00
R4223:Rttn UTSW 18 89095584 missense probably damaging 1.00
R4273:Rttn UTSW 18 89091896 missense probably benign
R4517:Rttn UTSW 18 89028973 missense probably damaging 0.99
R4674:Rttn UTSW 18 89011011 splice site probably null
R4837:Rttn UTSW 18 89090415 splice site probably null
R4869:Rttn UTSW 18 89043014 nonsense probably null
R4881:Rttn UTSW 18 89101685 missense probably damaging 1.00
R4959:Rttn UTSW 18 89042168 missense probably damaging 1.00
R4973:Rttn UTSW 18 89042168 missense probably damaging 1.00
R4975:Rttn UTSW 18 89064085 splice site probably null
R5166:Rttn UTSW 18 89013094 missense possibly damaging 0.48
R5243:Rttn UTSW 18 89108063 missense possibly damaging 0.74
R5594:Rttn UTSW 18 89090436 missense possibly damaging 0.95
R5654:Rttn UTSW 18 89048432 missense probably benign
R5794:Rttn UTSW 18 88995569 missense probably benign 0.18
R5799:Rttn UTSW 18 89037946 missense probably damaging 0.99
R5955:Rttn UTSW 18 89121009 missense probably damaging 0.99
R5963:Rttn UTSW 18 89073695 missense probably benign 0.01
R5989:Rttn UTSW 18 88973626 missense probably damaging 1.00
R6004:Rttn UTSW 18 89021692 missense probably damaging 0.96
R6132:Rttn UTSW 18 89115646 critical splice donor site probably null
R6430:Rttn UTSW 18 89021685 missense probably null 0.18
R6436:Rttn UTSW 18 89110729 missense probably damaging 1.00
R6681:Rttn UTSW 18 89014611 missense probably damaging 1.00
R6994:Rttn UTSW 18 89028899 missense probably damaging 1.00
R7049:Rttn UTSW 18 89064216 missense probably damaging 1.00
R7078:Rttn UTSW 18 89009422 missense probably benign 0.03
R7083:Rttn UTSW 18 89090598 missense probably damaging 1.00
R7250:Rttn UTSW 18 88989523 missense probably benign 0.03
R7402:Rttn UTSW 18 88985911 missense possibly damaging 0.92
R7565:Rttn UTSW 18 89060479 missense probably damaging 1.00
R7588:Rttn UTSW 18 89064229 missense probably damaging 0.97
R8029:Rttn UTSW 18 89090474 missense not run
R8085:Rttn UTSW 18 89053548 nonsense probably null
R8113:Rttn UTSW 18 89010916 missense probably damaging 1.00
R8355:Rttn UTSW 18 89028892 missense probably benign 0.05
R8531:Rttn UTSW 18 89113343 missense probably benign 0.00
R9008:Rttn UTSW 18 89009432 missense probably damaging 1.00
R9139:Rttn UTSW 18 89020137 missense probably benign 0.30
R9210:Rttn UTSW 18 89046162 critical splice donor site probably null
R9212:Rttn UTSW 18 89046162 critical splice donor site probably null
R9286:Rttn UTSW 18 88977725 missense probably benign 0.06
R9368:Rttn UTSW 18 89060452 missense probably damaging 1.00
R9632:Rttn UTSW 18 89017210 missense possibly damaging 0.82
R9710:Rttn UTSW 18 89017210 missense possibly damaging 0.82
X0017:Rttn UTSW 18 89113402 missense probably benign 0.01
X0022:Rttn UTSW 18 88973667 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACAGTCAGCGGTTAATGTG -3'
(R):5'- ACAAGTTTTCTCCCCAAGACTC -3'

Sequencing Primer
(F):5'- GAAGTACCTCCTCAGAGTTGCCTAG -3'
(R):5'- AAGACTCTTATTCTGCCATGCAC -3'
Posted On 2021-10-11