Mutagenetix > Incidental Mutation

Incidental Mutation 'R8993:A830018L16Rik'

684516

Institutional Source

Beutler Lab

Gene Symbol

A830018L16Rik

Ensembl Gene

ENSMUSG00000057715

Gene Name

RIKEN cDNA A830018L16 gene

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.056) question?

Stock #

R8993 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

11414105-11975901 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 11545267 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 155 (E155*)

Ref Sequence

ENSEMBL: ENSMUSP00000117421 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048613] [ENSMUST00000135014] [ENSMUST00000137824] [ENSMUST00000141512] [ENSMUST00000171690] [ENSMUST00000179089]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000048613
AA Change: E155*

SMART Domains

Protein: ENSMUSP00000043857
Gene: ENSMUSG00000057715
AA Change: E155*

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC
low complexity region	233	248	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000135014
AA Change: E155*

SMART Domains

Protein: ENSMUSP00000119143
Gene: ENSMUSG00000057715
AA Change: E155*

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC
low complexity region	233	248	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000137824
AA Change: E155*

SMART Domains

Protein: ENSMUSP00000117421
Gene: ENSMUSG00000057715
AA Change: E155*

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC
low complexity region	233	248	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000141339
AA Change: E51*

SMART Domains

Protein: ENSMUSP00000121311
Gene: ENSMUSG00000057715
AA Change: E51*

Domain	Start	End	E-Value	Type
low complexity region	110	120	N/A	INTRINSIC
low complexity region	130	145	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000141512
AA Change: E155*

SMART Domains

Protein: ENSMUSP00000139635
Gene: ENSMUSG00000057715
AA Change: E155*

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000171690
AA Change: E155*

SMART Domains

Protein: ENSMUSP00000132334
Gene: ENSMUSG00000057715
AA Change: E155*

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC
low complexity region	233	248	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000179089
AA Change: E155*

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to the cyclic AMP dependent protein kinase regulators. Naturally occurring mutations in this gene are associated with an increased risk for severe toxicities, such as diarrhea and neutropenia, in patients undergoing chemotherapeutic treatment. [provided by RefSeq, Mar 2017]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700069L16Rik	A	T	5: 113,703,781	C92*	probably null	Het
Acaa1a	A	T	9: 119,349,352		probably null	Het
Adcy4	T	C	14: 55,771,378	E864G	probably null	Het
Adcy4	T	C	14: 55,778,699	D387G	probably damaging	Het
Ank1	C	T	8: 23,098,939	H574Y	probably damaging	Het
Arhgef16	C	T	4: 154,287,038	E233K	probably damaging	Het
Arhgef26	A	T	3: 62,448,104	Y699F	probably benign	Het
BB014433	C	T	8: 15,042,101	V251M	probably damaging	Het
Bcan	G	A	3: 87,994,222	A391V	probably benign	Het
Bod1l	A	C	5: 41,816,867	V2368G	probably benign	Het
Braf	A	G	6: 39,662,151	V222A	probably damaging	Het
Cd33	G	T	7: 43,533,447		probably benign	Het
Cdkl2	T	A	5: 92,022,151	K324N	probably damaging	Het
Celf6	A	T	9: 59,602,871	T199S	probably damaging	Het
Cmtm4	A	C	8: 104,355,166	D196E	probably benign	Het
Cntn1	G	A	15: 92,234,466	V148M	probably damaging	Het
Col1a2	C	A	6: 4,535,451	P921H	unknown	Het
Crmp1	T	C	5: 37,242,146	M1T	probably null	Het
Dnah7a	A	T	1: 53,504,103	Y2303N	probably damaging	Het
Dock10	G	T	1: 80,574,171	T650K	probably benign	Het
Fam24a	A	G	7: 131,336,540	D53G	probably benign	Het
Foxa2	A	T	2: 148,044,706	M69K	probably benign	Het
Gatad2a	T	A	8: 69,909,935	H601L	probably damaging	Het
Gimap4	A	C	6: 48,690,605	D98A	probably damaging	Het
Gm14295	G	T	2: 176,809,830	R371L	possibly damaging	Het
Gm5039	A	G	12: 88,321,400	F28L	probably benign	Het
Golim4	G	T	3: 75,878,128	A652E	probably benign	Het
Grid1	A	G	14: 35,026,942	I240V	probably benign	Het
Iqsec3	T	A	6: 121,413,313	T400S	unknown	Het
Itk	G	A	11: 46,334,908	R539C	probably damaging	Het
Kdelc1	G	T	1: 44,112,764	L322I	possibly damaging	Het
Kif27	T	A	13: 58,326,098	D695V	possibly damaging	Het
Krt79	T	C	15: 101,931,006		probably benign	Het
Lama2	C	A	10: 27,422,714	V129L	possibly damaging	Het
Lonrf1	C	A	8: 36,229,238	E552D	possibly damaging	Het
Mpp3	A	G	11: 102,000,665	I549T	probably benign	Het
Nat1	T	C	8: 67,491,742	Y260H	probably benign	Het
Nipal2	T	A	15: 34,648,837	K69*	probably null	Het
Nlrx1	G	T	9: 44,256,941		probably benign	Het
Pde1b	C	A	15: 103,521,425	A115E	probably benign	Het
Pde4dip	A	G	3: 97,766,494	Y369H	probably damaging	Het
Pnpla7	A	G	2: 25,053,419	Y1286C	possibly damaging	Het
Pramel5	T	C	4: 144,272,959	E186G	possibly damaging	Het
Qdpr	C	T	5: 45,450,044	G20D	probably damaging	Het
Rmnd1	T	G	10: 4,407,918	I364L	probably benign	Het
Slc5a4a	A	T	10: 76,186,535	E568V	probably benign	Het
Slc6a18	T	A	13: 73,668,271	I330F	probably benign	Het
Spesp1	T	C	9: 62,273,270	T119A	possibly damaging	Het
Sypl	G	A	12: 32,975,663	S242N	probably benign	Het
Tbx18	G	A	9: 87,730,717	T43M	probably benign	Het
Tm7sf2	T	A	19: 6,063,926	D263V	probably damaging	Het
Trbv21	T	C	6: 41,202,990	I80T	probably damaging	Het
Ttc3	T	A	16: 94,427,808	L747Q	possibly damaging	Het
Ttll11	T	C	2: 35,817,801	D498G	possibly damaging	Het
Ttn	T	C	2: 76,753,370	Y22431C	probably null	Het
Ubtfl1	T	A	9: 18,410,341	S388R		Het
Vmn2r118	A	T	17: 55,610,835	L226I	possibly damaging	Het
Wdr46	A	G	17: 33,949,182	H576R	probably benign	Het
Zfp426	A	G	9: 20,475,000	F62L	probably damaging	Het

Other mutations in A830018L16Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:A830018L16Rik	APN	1	11748054	missense	probably damaging	0.98
IGL01916:A830018L16Rik	APN	1	11748107	splice site	probably benign
IGL02040:A830018L16Rik	APN	1	11933598	intron	probably benign
IGL02432:A830018L16Rik	APN	1	11748079	missense	probably damaging	1.00
IGL02693:A830018L16Rik	APN	1	11596282	missense	probably damaging	1.00
IGL02736:A830018L16Rik	APN	1	11972051	missense	probably benign	0.02
IGL03293:A830018L16Rik	APN	1	11545151	splice site	probably null
IGL02835:A830018L16Rik	UTSW	1	11972055	missense	possibly damaging	0.54
R1203:A830018L16Rik	UTSW	1	11518594	missense	probably damaging	1.00
R1216:A830018L16Rik	UTSW	1	11798492	missense	probably damaging	0.99
R1548:A830018L16Rik	UTSW	1	11518594	missense	probably damaging	1.00
R1644:A830018L16Rik	UTSW	1	11414590	nonsense	probably null
R1855:A830018L16Rik	UTSW	1	11747971	missense	probably damaging	1.00
R1858:A830018L16Rik	UTSW	1	11974953	missense	unknown
R2265:A830018L16Rik	UTSW	1	11972104	critical splice donor site	probably null
R2296:A830018L16Rik	UTSW	1	11512051	missense	possibly damaging	0.94
R2484:A830018L16Rik	UTSW	1	11596302	missense	probably damaging	1.00
R3730:A830018L16Rik	UTSW	1	11545226	missense	probably damaging	1.00
R3752:A830018L16Rik	UTSW	1	11518680	missense	probably damaging	1.00
R3861:A830018L16Rik	UTSW	1	11588554	splice site	probably benign
R4305:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4306:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4307:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4558:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4598:A830018L16Rik	UTSW	1	11747964	critical splice acceptor site	probably null
R4652:A830018L16Rik	UTSW	1	11537342	intron	probably benign
R5492:A830018L16Rik	UTSW	1	11545207	missense	probably damaging	0.99
R5493:A830018L16Rik	UTSW	1	11545207	missense	probably damaging	0.99
R5802:A830018L16Rik	UTSW	1	11950964	missense	probably damaging	1.00
R6007:A830018L16Rik	UTSW	1	11511916	critical splice acceptor site	probably null
R6082:A830018L16Rik	UTSW	1	11798528	missense	probably benign	0.04
R6376:A830018L16Rik	UTSW	1	11798494	missense	probably damaging	0.98
R6453:A830018L16Rik	UTSW	1	11798558	missense	possibly damaging	0.91
R6757:A830018L16Rik	UTSW	1	11596334	makesense	probably null
R6833:A830018L16Rik	UTSW	1	11588509	missense	probably damaging	1.00
R7163:A830018L16Rik	UTSW	1	11414624	missense	probably damaging	0.96
R7272:A830018L16Rik	UTSW	1	11588471	missense	probably damaging	0.97
R7566:A830018L16Rik	UTSW	1	11951028	missense	probably damaging	1.00
R7665:A830018L16Rik	UTSW	1	11972099	missense	probably damaging	0.96
R8004:A830018L16Rik	UTSW	1	11951062	splice site	probably benign
R8754:A830018L16Rik	UTSW	1	11545248	missense	probably benign	0.33
R8944:A830018L16Rik	UTSW	1	11414482	unclassified	probably benign
R8997:A830018L16Rik	UTSW	1	11545267	nonsense	probably null
R9098:A830018L16Rik	UTSW	1	11562987	missense	probably damaging	1.00
R9640:A830018L16Rik	UTSW	1	11950976	missense	probably damaging	0.98
R9704:A830018L16Rik	UTSW	1	11518689	missense	probably damaging	1.00
R9705:A830018L16Rik	UTSW	1	11518689	missense	probably damaging	1.00
Z1176:A830018L16Rik	UTSW	1	11518625	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TCTTGCACAAATGATAAATGGTGAG -3'
(R):5'- AGGTCCTATAGCTCCTGCCTG -3'

Sequencing Primer
(F):5'- GAGTTTTGTATCACTGTATGACATGC -3'
(R):5'- TCACAGATCTGTTCCATGGCACAG -3'

Posted On

2021-10-11