Incidental Mutation 'R8993:A830018L16Rik'
ID 684516
Institutional Source Beutler Lab
Gene Symbol A830018L16Rik
Ensembl Gene ENSMUSG00000057715
Gene Name RIKEN cDNA A830018L16 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock # R8993 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 11414105-11975901 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 11545267 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 155 (E155*)
Ref Sequence ENSEMBL: ENSMUSP00000117421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048613] [ENSMUST00000135014] [ENSMUST00000137824] [ENSMUST00000141512] [ENSMUST00000171690] [ENSMUST00000179089]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000048613
AA Change: E155*
SMART Domains Protein: ENSMUSP00000043857
Gene: ENSMUSG00000057715
AA Change: E155*

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
low complexity region 233 248 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135014
AA Change: E155*
SMART Domains Protein: ENSMUSP00000119143
Gene: ENSMUSG00000057715
AA Change: E155*

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
low complexity region 233 248 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000137824
AA Change: E155*
SMART Domains Protein: ENSMUSP00000117421
Gene: ENSMUSG00000057715
AA Change: E155*

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
low complexity region 233 248 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000141339
AA Change: E51*
SMART Domains Protein: ENSMUSP00000121311
Gene: ENSMUSG00000057715
AA Change: E51*

DomainStartEndE-ValueType
low complexity region 110 120 N/A INTRINSIC
low complexity region 130 145 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000141512
AA Change: E155*
SMART Domains Protein: ENSMUSP00000139635
Gene: ENSMUSG00000057715
AA Change: E155*

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171690
AA Change: E155*
SMART Domains Protein: ENSMUSP00000132334
Gene: ENSMUSG00000057715
AA Change: E155*

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
low complexity region 233 248 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000179089
AA Change: E155*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to the cyclic AMP dependent protein kinase regulators. Naturally occurring mutations in this gene are associated with an increased risk for severe toxicities, such as diarrhea and neutropenia, in patients undergoing chemotherapeutic treatment. [provided by RefSeq, Mar 2017]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A T 5: 113,703,781 C92* probably null Het
Acaa1a A T 9: 119,349,352 probably null Het
Adcy4 T C 14: 55,771,378 E864G probably null Het
Adcy4 T C 14: 55,778,699 D387G probably damaging Het
Ank1 C T 8: 23,098,939 H574Y probably damaging Het
Arhgef16 C T 4: 154,287,038 E233K probably damaging Het
Arhgef26 A T 3: 62,448,104 Y699F probably benign Het
BB014433 C T 8: 15,042,101 V251M probably damaging Het
Bcan G A 3: 87,994,222 A391V probably benign Het
Bod1l A C 5: 41,816,867 V2368G probably benign Het
Braf A G 6: 39,662,151 V222A probably damaging Het
Cd33 G T 7: 43,533,447 probably benign Het
Cdkl2 T A 5: 92,022,151 K324N probably damaging Het
Celf6 A T 9: 59,602,871 T199S probably damaging Het
Cmtm4 A C 8: 104,355,166 D196E probably benign Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Col1a2 C A 6: 4,535,451 P921H unknown Het
Crmp1 T C 5: 37,242,146 M1T probably null Het
Dnah7a A T 1: 53,504,103 Y2303N probably damaging Het
Dock10 G T 1: 80,574,171 T650K probably benign Het
Fam24a A G 7: 131,336,540 D53G probably benign Het
Foxa2 A T 2: 148,044,706 M69K probably benign Het
Gatad2a T A 8: 69,909,935 H601L probably damaging Het
Gimap4 A C 6: 48,690,605 D98A probably damaging Het
Gm14295 G T 2: 176,809,830 R371L possibly damaging Het
Gm5039 A G 12: 88,321,400 F28L probably benign Het
Golim4 G T 3: 75,878,128 A652E probably benign Het
Grid1 A G 14: 35,026,942 I240V probably benign Het
Iqsec3 T A 6: 121,413,313 T400S unknown Het
Itk G A 11: 46,334,908 R539C probably damaging Het
Kdelc1 G T 1: 44,112,764 L322I possibly damaging Het
Kif27 T A 13: 58,326,098 D695V possibly damaging Het
Krt79 T C 15: 101,931,006 probably benign Het
Lama2 C A 10: 27,422,714 V129L possibly damaging Het
Lonrf1 C A 8: 36,229,238 E552D possibly damaging Het
Mpp3 A G 11: 102,000,665 I549T probably benign Het
Nat1 T C 8: 67,491,742 Y260H probably benign Het
Nipal2 T A 15: 34,648,837 K69* probably null Het
Nlrx1 G T 9: 44,256,941 probably benign Het
Pde1b C A 15: 103,521,425 A115E probably benign Het
Pde4dip A G 3: 97,766,494 Y369H probably damaging Het
Pnpla7 A G 2: 25,053,419 Y1286C possibly damaging Het
Pramel5 T C 4: 144,272,959 E186G possibly damaging Het
Qdpr C T 5: 45,450,044 G20D probably damaging Het
Rmnd1 T G 10: 4,407,918 I364L probably benign Het
Slc5a4a A T 10: 76,186,535 E568V probably benign Het
Slc6a18 T A 13: 73,668,271 I330F probably benign Het
Spesp1 T C 9: 62,273,270 T119A possibly damaging Het
Sypl G A 12: 32,975,663 S242N probably benign Het
Tbx18 G A 9: 87,730,717 T43M probably benign Het
Tm7sf2 T A 19: 6,063,926 D263V probably damaging Het
Trbv21 T C 6: 41,202,990 I80T probably damaging Het
Ttc3 T A 16: 94,427,808 L747Q possibly damaging Het
Ttll11 T C 2: 35,817,801 D498G possibly damaging Het
Ttn T C 2: 76,753,370 Y22431C probably null Het
Ubtfl1 T A 9: 18,410,341 S388R Het
Vmn2r118 A T 17: 55,610,835 L226I possibly damaging Het
Wdr46 A G 17: 33,949,182 H576R probably benign Het
Zfp426 A G 9: 20,475,000 F62L probably damaging Het
Other mutations in A830018L16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:A830018L16Rik APN 1 11748054 missense probably damaging 0.98
IGL01916:A830018L16Rik APN 1 11748107 splice site probably benign
IGL02040:A830018L16Rik APN 1 11933598 intron probably benign
IGL02432:A830018L16Rik APN 1 11748079 missense probably damaging 1.00
IGL02693:A830018L16Rik APN 1 11596282 missense probably damaging 1.00
IGL02736:A830018L16Rik APN 1 11972051 missense probably benign 0.02
IGL03293:A830018L16Rik APN 1 11545151 splice site probably null
IGL02835:A830018L16Rik UTSW 1 11972055 missense possibly damaging 0.54
R1203:A830018L16Rik UTSW 1 11518594 missense probably damaging 1.00
R1216:A830018L16Rik UTSW 1 11798492 missense probably damaging 0.99
R1548:A830018L16Rik UTSW 1 11518594 missense probably damaging 1.00
R1644:A830018L16Rik UTSW 1 11414590 nonsense probably null
R1855:A830018L16Rik UTSW 1 11747971 missense probably damaging 1.00
R1858:A830018L16Rik UTSW 1 11974953 missense unknown
R2265:A830018L16Rik UTSW 1 11972104 critical splice donor site probably null
R2296:A830018L16Rik UTSW 1 11512051 missense possibly damaging 0.94
R2484:A830018L16Rik UTSW 1 11596302 missense probably damaging 1.00
R3730:A830018L16Rik UTSW 1 11545226 missense probably damaging 1.00
R3752:A830018L16Rik UTSW 1 11518680 missense probably damaging 1.00
R3861:A830018L16Rik UTSW 1 11588554 splice site probably benign
R4305:A830018L16Rik UTSW 1 11972076 nonsense probably null
R4306:A830018L16Rik UTSW 1 11972076 nonsense probably null
R4307:A830018L16Rik UTSW 1 11972076 nonsense probably null
R4558:A830018L16Rik UTSW 1 11972076 nonsense probably null
R4598:A830018L16Rik UTSW 1 11747964 critical splice acceptor site probably null
R4652:A830018L16Rik UTSW 1 11537342 intron probably benign
R5492:A830018L16Rik UTSW 1 11545207 missense probably damaging 0.99
R5493:A830018L16Rik UTSW 1 11545207 missense probably damaging 0.99
R5802:A830018L16Rik UTSW 1 11950964 missense probably damaging 1.00
R6007:A830018L16Rik UTSW 1 11511916 critical splice acceptor site probably null
R6082:A830018L16Rik UTSW 1 11798528 missense probably benign 0.04
R6376:A830018L16Rik UTSW 1 11798494 missense probably damaging 0.98
R6453:A830018L16Rik UTSW 1 11798558 missense possibly damaging 0.91
R6757:A830018L16Rik UTSW 1 11596334 makesense probably null
R6833:A830018L16Rik UTSW 1 11588509 missense probably damaging 1.00
R7163:A830018L16Rik UTSW 1 11414624 missense probably damaging 0.96
R7272:A830018L16Rik UTSW 1 11588471 missense probably damaging 0.97
R7566:A830018L16Rik UTSW 1 11951028 missense probably damaging 1.00
R7665:A830018L16Rik UTSW 1 11972099 missense probably damaging 0.96
R8004:A830018L16Rik UTSW 1 11951062 splice site probably benign
R8754:A830018L16Rik UTSW 1 11545248 missense probably benign 0.33
R8944:A830018L16Rik UTSW 1 11414482 unclassified probably benign
R8997:A830018L16Rik UTSW 1 11545267 nonsense probably null
R9098:A830018L16Rik UTSW 1 11562987 missense probably damaging 1.00
Z1176:A830018L16Rik UTSW 1 11518625 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTTGCACAAATGATAAATGGTGAG -3'
(R):5'- AGGTCCTATAGCTCCTGCCTG -3'

Sequencing Primer
(F):5'- GAGTTTTGTATCACTGTATGACATGC -3'
(R):5'- TCACAGATCTGTTCCATGGCACAG -3'
Posted On 2021-10-11