Incidental Mutation 'R8993:Dock10'
ID 684519
Institutional Source Beutler Lab
Gene Symbol Dock10
Ensembl Gene ENSMUSG00000038608
Gene Name dedicator of cytokinesis 10
Synonyms Zizimin3, A630054M16Rik, Jr5, ZIZ3, Jr4, 9330153B10Rik
MMRRC Submission 068824-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.487) question?
Stock # R8993 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 80478790-80736244 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 80551888 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 650 (T650K)
Ref Sequence ENSEMBL: ENSMUSP00000140085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077946] [ENSMUST00000187774] [ENSMUST00000190595] [ENSMUST00000190983]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000077946
AA Change: T662K

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000077099
Gene: ENSMUSG00000038608
AA Change: T662K

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
Pfam:DUF3398 61 153 1.7e-36 PFAM
PH 182 292 8.5e-17 SMART
Blast:PH 350 458 7e-18 BLAST
Pfam:DOCK-C2 668 859 1e-50 PFAM
low complexity region 1269 1279 N/A INTRINSIC
low complexity region 1284 1295 N/A INTRINSIC
Pfam:DHR-2 1592 2143 1.3e-216 PFAM
low complexity region 2174 2187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187774
AA Change: T650K

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140085
Gene: ENSMUSG00000038608
AA Change: T650K

DomainStartEndE-ValueType
Pfam:DUF3398 46 141 9e-29 PFAM
PH 170 280 3.9e-19 SMART
Blast:PH 338 446 7e-18 BLAST
Pfam:DOCK-C2 655 848 1.5e-54 PFAM
low complexity region 1257 1267 N/A INTRINSIC
low complexity region 1272 1283 N/A INTRINSIC
low complexity region 1870 1890 N/A INTRINSIC
Pfam:Ded_cyto 1954 2131 3.4e-65 PFAM
low complexity region 2162 2175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190595
AA Change: T315K

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139567
Gene: ENSMUSG00000038608
AA Change: T315K

DomainStartEndE-ValueType
Blast:PH 3 111 5e-18 BLAST
Pfam:DOCK-C2 320 513 1.2e-54 PFAM
low complexity region 922 932 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
Pfam:Ded_cyto 1588 1765 2.7e-65 PFAM
low complexity region 1783 1795 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190983
AA Change: T649K

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000140719
Gene: ENSMUSG00000038608
AA Change: T649K

DomainStartEndE-ValueType
Pfam:DUF3398 45 140 8.9e-29 PFAM
PH 169 279 3.9e-19 SMART
Blast:PH 337 445 7e-18 BLAST
Pfam:DOCK-C2 654 847 1.5e-54 PFAM
low complexity region 1256 1266 N/A INTRINSIC
low complexity region 1271 1282 N/A INTRINSIC
low complexity region 1869 1889 N/A INTRINSIC
Pfam:Ded_cyto 1953 2130 3.4e-65 PFAM
Meta Mutation Damage Score 0.2037 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family are guanosine nucleotide exchange factors for Rho GTPases and defined by the presence of conserved DOCK-homology regions. The encoded protein belongs to the D (or Zizimin) subfamily of DOCK proteins, which also contain an N-terminal pleckstrin homology domain. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction of B cell numbers in secondary lymphoid organs. Follicular B cells show membrane CD23 overexpression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A T 5: 113,841,842 (GRCm39) C92* probably null Het
A830018L16Rik G T 1: 11,615,491 (GRCm39) E155* probably null Het
Acaa1a A T 9: 119,178,418 (GRCm39) probably null Het
Adcy4 T C 14: 56,008,835 (GRCm39) E864G probably null Het
Adcy4 T C 14: 56,016,156 (GRCm39) D387G probably damaging Het
Ank1 C T 8: 23,588,955 (GRCm39) H574Y probably damaging Het
Arhgef16 C T 4: 154,371,495 (GRCm39) E233K probably damaging Het
Arhgef26 A T 3: 62,355,525 (GRCm39) Y699F probably benign Het
BB014433 C T 8: 15,092,101 (GRCm39) V251M probably damaging Het
Bcan G A 3: 87,901,529 (GRCm39) A391V probably benign Het
Bod1l A C 5: 41,974,210 (GRCm39) V2368G probably benign Het
Braf A G 6: 39,639,085 (GRCm39) V222A probably damaging Het
Cd33 G T 7: 43,182,871 (GRCm39) probably benign Het
Cdkl2 T A 5: 92,170,010 (GRCm39) K324N probably damaging Het
Celf6 A T 9: 59,510,154 (GRCm39) T199S probably damaging Het
Cmtm4 A C 8: 105,081,798 (GRCm39) D196E probably benign Het
Cntn1 G A 15: 92,132,347 (GRCm39) V148M probably damaging Het
Col1a2 C A 6: 4,535,451 (GRCm39) P921H unknown Het
Crmp1 T C 5: 37,399,490 (GRCm39) M1T probably null Het
Dnah7a A T 1: 53,543,262 (GRCm39) Y2303N probably damaging Het
Eif1ad15 A G 12: 88,288,170 (GRCm39) F28L probably benign Het
Fam24a A G 7: 130,938,269 (GRCm39) D53G probably benign Het
Foxa2 A T 2: 147,886,626 (GRCm39) M69K probably benign Het
Gatad2a T A 8: 70,362,585 (GRCm39) H601L probably damaging Het
Gimap4 A C 6: 48,667,539 (GRCm39) D98A probably damaging Het
Gm14295 G T 2: 176,501,623 (GRCm39) R371L possibly damaging Het
Golim4 G T 3: 75,785,435 (GRCm39) A652E probably benign Het
Grid1 A G 14: 34,748,899 (GRCm39) I240V probably benign Het
Iqsec3 T A 6: 121,390,272 (GRCm39) T400S unknown Het
Itk G A 11: 46,225,735 (GRCm39) R539C probably damaging Het
Kif27 T A 13: 58,473,912 (GRCm39) D695V possibly damaging Het
Krt79 T C 15: 101,839,441 (GRCm39) probably benign Het
Lama2 C A 10: 27,298,710 (GRCm39) V129L possibly damaging Het
Lonrf1 C A 8: 36,696,392 (GRCm39) E552D possibly damaging Het
Mpp3 A G 11: 101,891,491 (GRCm39) I549T probably benign Het
Nat1 T C 8: 67,944,394 (GRCm39) Y260H probably benign Het
Nipal2 T A 15: 34,648,983 (GRCm39) K69* probably null Het
Nlrx1 G T 9: 44,168,238 (GRCm39) probably benign Het
Pde1b C A 15: 103,429,852 (GRCm39) A115E probably benign Het
Pde4dip A G 3: 97,673,810 (GRCm39) Y369H probably damaging Het
Pnpla7 A G 2: 24,943,431 (GRCm39) Y1286C possibly damaging Het
Poglut2 G T 1: 44,151,924 (GRCm39) L322I possibly damaging Het
Pramel5 T C 4: 143,999,529 (GRCm39) E186G possibly damaging Het
Qdpr C T 5: 45,607,386 (GRCm39) G20D probably damaging Het
Rmnd1 T G 10: 4,357,918 (GRCm39) I364L probably benign Het
Slc5a4a A T 10: 76,022,369 (GRCm39) E568V probably benign Het
Slc6a18 T A 13: 73,816,390 (GRCm39) I330F probably benign Het
Spesp1 T C 9: 62,180,552 (GRCm39) T119A possibly damaging Het
Sypl1 G A 12: 33,025,662 (GRCm39) S242N probably benign Het
Tbx18 G A 9: 87,612,770 (GRCm39) T43M probably benign Het
Tm7sf2 T A 19: 6,113,956 (GRCm39) D263V probably damaging Het
Trbv21 T C 6: 41,179,924 (GRCm39) I80T probably damaging Het
Ttc3 T A 16: 94,228,667 (GRCm39) L747Q possibly damaging Het
Ttll11 T C 2: 35,707,813 (GRCm39) D498G possibly damaging Het
Ttn T C 2: 76,583,714 (GRCm39) Y22431C probably null Het
Ubtfl1 T A 9: 18,321,637 (GRCm39) S388R Het
Vmn2r118 A T 17: 55,917,835 (GRCm39) L226I possibly damaging Het
Wdr46 A G 17: 34,168,156 (GRCm39) H576R probably benign Het
Zfp426 A G 9: 20,386,296 (GRCm39) F62L probably damaging Het
Other mutations in Dock10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Dock10 APN 1 80,562,729 (GRCm39) missense probably damaging 1.00
IGL00783:Dock10 APN 1 80,550,166 (GRCm39) splice site probably benign
IGL00784:Dock10 APN 1 80,550,166 (GRCm39) splice site probably benign
IGL00858:Dock10 APN 1 80,545,720 (GRCm39) missense possibly damaging 0.48
IGL01298:Dock10 APN 1 80,508,962 (GRCm39) missense probably damaging 1.00
IGL01351:Dock10 APN 1 80,570,876 (GRCm39) missense probably damaging 1.00
IGL01356:Dock10 APN 1 80,501,459 (GRCm39) missense probably damaging 1.00
IGL01584:Dock10 APN 1 80,511,567 (GRCm39) missense probably damaging 0.99
IGL01619:Dock10 APN 1 80,612,015 (GRCm39) splice site probably benign
IGL01678:Dock10 APN 1 80,521,069 (GRCm39) missense probably damaging 1.00
IGL01759:Dock10 APN 1 80,503,990 (GRCm39) missense probably damaging 1.00
IGL02238:Dock10 APN 1 80,511,510 (GRCm39) missense probably damaging 0.99
IGL02352:Dock10 APN 1 80,483,378 (GRCm39) missense probably damaging 1.00
IGL02359:Dock10 APN 1 80,483,378 (GRCm39) missense probably damaging 1.00
IGL02377:Dock10 APN 1 80,562,711 (GRCm39) critical splice donor site probably null
IGL02433:Dock10 APN 1 80,507,905 (GRCm39) missense probably damaging 1.00
IGL02471:Dock10 APN 1 80,493,339 (GRCm39) missense probably damaging 0.99
IGL02645:Dock10 APN 1 80,551,840 (GRCm39) missense probably damaging 1.00
IGL02646:Dock10 APN 1 80,551,840 (GRCm39) missense probably damaging 1.00
IGL02648:Dock10 APN 1 80,551,840 (GRCm39) missense probably damaging 1.00
IGL02649:Dock10 APN 1 80,551,840 (GRCm39) missense probably damaging 1.00
IGL02650:Dock10 APN 1 80,551,840 (GRCm39) missense probably damaging 1.00
IGL02652:Dock10 APN 1 80,570,561 (GRCm39) splice site probably null
IGL02718:Dock10 APN 1 80,501,535 (GRCm39) missense probably benign 0.00
IGL02998:Dock10 APN 1 80,551,259 (GRCm39) missense probably damaging 1.00
IGL03057:Dock10 APN 1 80,545,088 (GRCm39) missense probably damaging 1.00
IGL03066:Dock10 APN 1 80,562,758 (GRCm39) missense probably benign 0.00
IGL03106:Dock10 APN 1 80,546,551 (GRCm39) missense probably damaging 0.98
IGL03148:Dock10 APN 1 80,518,075 (GRCm39) missense probably benign 0.01
IGL03271:Dock10 APN 1 80,483,126 (GRCm39) missense probably damaging 1.00
IGL03352:Dock10 APN 1 80,584,013 (GRCm39) splice site probably benign
LCD18:Dock10 UTSW 1 80,716,623 (GRCm38) intron probably benign
PIT4366001:Dock10 UTSW 1 80,573,438 (GRCm39) missense probably benign 0.30
PIT4581001:Dock10 UTSW 1 80,483,163 (GRCm39) missense probably damaging 1.00
R0019:Dock10 UTSW 1 80,583,642 (GRCm39) missense probably damaging 1.00
R0081:Dock10 UTSW 1 80,584,295 (GRCm39) missense probably damaging 0.99
R0095:Dock10 UTSW 1 80,501,788 (GRCm39) missense probably benign 0.00
R0241:Dock10 UTSW 1 80,556,340 (GRCm39) missense probably benign
R0241:Dock10 UTSW 1 80,556,340 (GRCm39) missense probably benign
R0255:Dock10 UTSW 1 80,583,593 (GRCm39) missense probably damaging 1.00
R0267:Dock10 UTSW 1 80,490,171 (GRCm39) missense probably damaging 1.00
R0299:Dock10 UTSW 1 80,514,646 (GRCm39) missense probably damaging 0.99
R0365:Dock10 UTSW 1 80,573,400 (GRCm39) missense probably damaging 1.00
R0387:Dock10 UTSW 1 80,517,993 (GRCm39) missense probably damaging 1.00
R0403:Dock10 UTSW 1 80,501,787 (GRCm39) missense possibly damaging 0.94
R0408:Dock10 UTSW 1 80,518,193 (GRCm39) missense probably benign 0.03
R0414:Dock10 UTSW 1 80,513,650 (GRCm39) missense possibly damaging 0.93
R0591:Dock10 UTSW 1 80,518,936 (GRCm39) splice site probably benign
R0698:Dock10 UTSW 1 80,507,895 (GRCm39) missense probably damaging 1.00
R0711:Dock10 UTSW 1 80,501,692 (GRCm39) missense probably damaging 1.00
R0925:Dock10 UTSW 1 80,514,657 (GRCm39) missense probably benign 0.20
R1162:Dock10 UTSW 1 80,546,559 (GRCm39) missense possibly damaging 0.58
R1370:Dock10 UTSW 1 80,518,060 (GRCm39) missense probably damaging 1.00
R1440:Dock10 UTSW 1 80,526,853 (GRCm39) missense probably benign 0.03
R1469:Dock10 UTSW 1 80,490,275 (GRCm39) missense probably benign 0.05
R1469:Dock10 UTSW 1 80,490,275 (GRCm39) missense probably benign 0.05
R1525:Dock10 UTSW 1 80,583,881 (GRCm39) critical splice donor site probably null
R1544:Dock10 UTSW 1 80,570,352 (GRCm39) missense probably benign 0.00
R1601:Dock10 UTSW 1 80,527,519 (GRCm39) missense probably benign 0.00
R1757:Dock10 UTSW 1 80,511,586 (GRCm39) missense probably damaging 1.00
R1765:Dock10 UTSW 1 80,583,540 (GRCm39) missense probably damaging 1.00
R1783:Dock10 UTSW 1 80,551,897 (GRCm39) missense probably benign 0.17
R1823:Dock10 UTSW 1 80,520,814 (GRCm39) splice site probably null
R1827:Dock10 UTSW 1 80,508,009 (GRCm39) missense probably benign 0.07
R1844:Dock10 UTSW 1 80,520,918 (GRCm39) missense probably damaging 0.99
R1856:Dock10 UTSW 1 80,584,285 (GRCm39) missense possibly damaging 0.46
R1974:Dock10 UTSW 1 80,488,143 (GRCm39) missense possibly damaging 0.50
R2006:Dock10 UTSW 1 80,527,506 (GRCm39) missense possibly damaging 0.95
R2112:Dock10 UTSW 1 80,483,360 (GRCm39) missense probably damaging 0.99
R2112:Dock10 UTSW 1 80,483,359 (GRCm39) missense probably damaging 1.00
R2113:Dock10 UTSW 1 80,584,280 (GRCm39) missense probably damaging 1.00
R2439:Dock10 UTSW 1 80,510,149 (GRCm39) missense probably damaging 1.00
R2566:Dock10 UTSW 1 80,517,970 (GRCm39) missense possibly damaging 0.88
R3086:Dock10 UTSW 1 80,510,074 (GRCm39) missense possibly damaging 0.91
R3766:Dock10 UTSW 1 80,514,643 (GRCm39) missense probably damaging 0.99
R3768:Dock10 UTSW 1 80,510,085 (GRCm39) missense probably damaging 1.00
R4009:Dock10 UTSW 1 80,510,148 (GRCm39) missense probably damaging 1.00
R4016:Dock10 UTSW 1 80,584,286 (GRCm39) missense probably damaging 1.00
R4179:Dock10 UTSW 1 80,488,134 (GRCm39) missense probably benign 0.00
R4243:Dock10 UTSW 1 80,544,472 (GRCm39) missense probably benign 0.00
R4244:Dock10 UTSW 1 80,544,472 (GRCm39) missense probably benign 0.00
R4245:Dock10 UTSW 1 80,544,472 (GRCm39) missense probably benign 0.00
R4674:Dock10 UTSW 1 80,584,337 (GRCm39) missense possibly damaging 0.79
R4696:Dock10 UTSW 1 80,493,330 (GRCm39) missense possibly damaging 0.95
R4789:Dock10 UTSW 1 80,518,998 (GRCm39) missense probably damaging 1.00
R4851:Dock10 UTSW 1 80,526,874 (GRCm39) missense probably benign 0.33
R4911:Dock10 UTSW 1 80,583,953 (GRCm39) missense probably damaging 1.00
R4976:Dock10 UTSW 1 80,545,711 (GRCm39) critical splice donor site probably null
R5086:Dock10 UTSW 1 80,529,189 (GRCm39) missense possibly damaging 0.89
R5119:Dock10 UTSW 1 80,545,711 (GRCm39) critical splice donor site probably null
R5301:Dock10 UTSW 1 80,625,973 (GRCm39) missense probably benign 0.41
R5404:Dock10 UTSW 1 80,481,630 (GRCm39) intron probably benign
R5457:Dock10 UTSW 1 80,501,781 (GRCm39) missense probably damaging 1.00
R5790:Dock10 UTSW 1 80,482,887 (GRCm39) missense probably benign 0.00
R5845:Dock10 UTSW 1 80,483,459 (GRCm39) intron probably benign
R5871:Dock10 UTSW 1 80,519,057 (GRCm39) critical splice acceptor site probably null
R5873:Dock10 UTSW 1 80,551,855 (GRCm39) missense probably damaging 1.00
R5881:Dock10 UTSW 1 80,538,640 (GRCm39) missense probably benign 0.19
R5895:Dock10 UTSW 1 80,514,676 (GRCm39) missense probably benign
R5935:Dock10 UTSW 1 80,483,304 (GRCm39) intron probably benign
R5965:Dock10 UTSW 1 80,546,461 (GRCm39) splice site probably null
R5966:Dock10 UTSW 1 80,546,225 (GRCm39) missense possibly damaging 0.84
R6008:Dock10 UTSW 1 80,583,890 (GRCm39) missense probably damaging 0.98
R6029:Dock10 UTSW 1 80,514,663 (GRCm39) missense possibly damaging 0.68
R6083:Dock10 UTSW 1 80,510,148 (GRCm39) missense probably damaging 1.00
R6145:Dock10 UTSW 1 80,553,621 (GRCm39) nonsense probably null
R6257:Dock10 UTSW 1 80,481,413 (GRCm39) intron probably benign
R6274:Dock10 UTSW 1 80,516,540 (GRCm39) missense probably damaging 1.00
R6324:Dock10 UTSW 1 80,482,893 (GRCm39) missense probably benign 0.03
R6346:Dock10 UTSW 1 80,553,573 (GRCm39) splice site probably null
R6476:Dock10 UTSW 1 80,518,959 (GRCm39) nonsense probably null
R6516:Dock10 UTSW 1 80,518,178 (GRCm39) missense probably damaging 1.00
R6526:Dock10 UTSW 1 80,564,068 (GRCm39) missense probably damaging 0.97
R6534:Dock10 UTSW 1 80,481,388 (GRCm39) missense probably benign 0.01
R6620:Dock10 UTSW 1 80,570,355 (GRCm39) missense probably benign 0.01
R6640:Dock10 UTSW 1 80,511,555 (GRCm39) nonsense probably null
R6669:Dock10 UTSW 1 80,570,572 (GRCm39) missense probably damaging 1.00
R6672:Dock10 UTSW 1 80,490,248 (GRCm39) missense probably benign 0.00
R6679:Dock10 UTSW 1 80,544,514 (GRCm39) missense probably benign 0.11
R6682:Dock10 UTSW 1 80,490,338 (GRCm39) missense probably damaging 1.00
R6712:Dock10 UTSW 1 80,514,583 (GRCm39) missense probably benign 0.00
R6726:Dock10 UTSW 1 80,490,147 (GRCm39) missense probably damaging 1.00
R6788:Dock10 UTSW 1 80,508,962 (GRCm39) missense probably damaging 1.00
R6805:Dock10 UTSW 1 80,564,407 (GRCm39) missense probably benign
R6815:Dock10 UTSW 1 80,516,576 (GRCm39) missense possibly damaging 0.94
R6818:Dock10 UTSW 1 80,593,082 (GRCm39) missense possibly damaging 0.95
R6867:Dock10 UTSW 1 80,508,976 (GRCm39) missense probably damaging 1.00
R6964:Dock10 UTSW 1 80,481,365 (GRCm39) intron probably benign
R7026:Dock10 UTSW 1 80,479,504 (GRCm39) missense probably benign 0.40
R7084:Dock10 UTSW 1 80,481,573 (GRCm39) missense
R7087:Dock10 UTSW 1 80,570,543 (GRCm39) missense probably benign
R7158:Dock10 UTSW 1 80,564,589 (GRCm39) critical splice acceptor site probably null
R7191:Dock10 UTSW 1 80,518,048 (GRCm39) missense possibly damaging 0.93
R7214:Dock10 UTSW 1 80,546,246 (GRCm39) missense probably benign 0.01
R7255:Dock10 UTSW 1 80,520,816 (GRCm39) critical splice donor site probably null
R7320:Dock10 UTSW 1 80,527,421 (GRCm39) critical splice donor site probably null
R7359:Dock10 UTSW 1 80,687,065 (GRCm39) missense probably benign 0.01
R7423:Dock10 UTSW 1 80,501,497 (GRCm39) missense possibly damaging 0.67
R7464:Dock10 UTSW 1 80,518,032 (GRCm39) missense probably damaging 0.99
R7483:Dock10 UTSW 1 80,493,283 (GRCm39) missense probably benign 0.01
R7487:Dock10 UTSW 1 80,562,765 (GRCm39) missense probably benign 0.00
R7789:Dock10 UTSW 1 80,536,930 (GRCm39) missense possibly damaging 0.82
R7943:Dock10 UTSW 1 80,626,006 (GRCm39) missense probably damaging 0.98
R7962:Dock10 UTSW 1 80,564,085 (GRCm39) missense possibly damaging 0.88
R8079:Dock10 UTSW 1 80,556,421 (GRCm39) missense probably benign 0.00
R8086:Dock10 UTSW 1 80,481,707 (GRCm39) missense probably benign 0.17
R8184:Dock10 UTSW 1 80,530,469 (GRCm39) missense probably damaging 1.00
R8220:Dock10 UTSW 1 80,506,366 (GRCm39) missense probably null 1.00
R8225:Dock10 UTSW 1 80,481,447 (GRCm39) nonsense probably null
R8267:Dock10 UTSW 1 80,518,045 (GRCm39) missense probably benign 0.00
R8276:Dock10 UTSW 1 80,505,998 (GRCm39) missense probably benign
R8294:Dock10 UTSW 1 80,488,079 (GRCm39) missense possibly damaging 0.88
R8298:Dock10 UTSW 1 80,514,654 (GRCm39) missense probably benign 0.00
R8326:Dock10 UTSW 1 80,583,892 (GRCm39) missense possibly damaging 0.77
R8724:Dock10 UTSW 1 80,570,344 (GRCm39) missense probably benign 0.00
R8828:Dock10 UTSW 1 80,521,134 (GRCm39) missense probably damaging 1.00
R8846:Dock10 UTSW 1 80,545,786 (GRCm39) missense possibly damaging 0.93
R8919:Dock10 UTSW 1 80,483,147 (GRCm39) missense probably benign 0.00
R8950:Dock10 UTSW 1 80,519,016 (GRCm39) missense probably benign
R9028:Dock10 UTSW 1 80,584,012 (GRCm39) splice site probably benign
R9115:Dock10 UTSW 1 80,490,156 (GRCm39) missense probably damaging 1.00
R9327:Dock10 UTSW 1 80,510,184 (GRCm39) missense probably damaging 1.00
R9342:Dock10 UTSW 1 80,570,360 (GRCm39) missense probably benign
R9421:Dock10 UTSW 1 80,501,509 (GRCm39) missense probably damaging 1.00
R9431:Dock10 UTSW 1 80,583,593 (GRCm39) missense probably damaging 1.00
R9486:Dock10 UTSW 1 80,479,452 (GRCm39) missense unknown
R9521:Dock10 UTSW 1 80,501,763 (GRCm39) missense probably damaging 1.00
R9598:Dock10 UTSW 1 80,625,939 (GRCm39) missense probably benign 0.15
R9629:Dock10 UTSW 1 80,481,389 (GRCm39) missense
R9703:Dock10 UTSW 1 80,517,540 (GRCm39) missense probably damaging 0.98
RF021:Dock10 UTSW 1 80,542,290 (GRCm39) critical splice acceptor site probably null
X0025:Dock10 UTSW 1 80,514,637 (GRCm39) missense probably damaging 0.98
X0065:Dock10 UTSW 1 80,518,977 (GRCm39) missense probably damaging 1.00
Z1088:Dock10 UTSW 1 80,510,064 (GRCm39) missense probably damaging 1.00
Z1176:Dock10 UTSW 1 80,538,671 (GRCm39) missense probably benign
Z1177:Dock10 UTSW 1 80,536,917 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTAGATGCTCATTCAAGAACCATC -3'
(R):5'- AGTACACATCTCACATTTCCATGC -3'

Sequencing Primer
(F):5'- AAGAACCATCTTGTGTGGTCCAG -3'
(R):5'- CCATGCTCTTGGAACATAATATCAAG -3'
Posted On 2021-10-11