Incidental Mutation 'R8993:Foxa2'
ID 684523
Institutional Source Beutler Lab
Gene Symbol Foxa2
Ensembl Gene ENSMUSG00000037025
Gene Name forkhead box A2
Synonyms Hnf-3b, Hnf3b, Tcf-3b, HNF3-beta, Tcf3b, HNF3beta
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8993 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 148042877-148046969 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 148044706 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 69 (M69K)
Ref Sequence ENSEMBL: ENSMUSP00000105590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047315] [ENSMUST00000109964] [ENSMUST00000172928]
AlphaFold P35583
Predicted Effect possibly damaging
Transcript: ENSMUST00000047315
AA Change: M63K

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000045918
Gene: ENSMUSG00000037025
AA Change: M63K

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
low complexity region 44 67 N/A INTRINSIC
low complexity region 74 104 N/A INTRINSIC
low complexity region 113 125 N/A INTRINSIC
FH 157 247 4.77e-62 SMART
low complexity region 262 281 N/A INTRINSIC
low complexity region 326 365 N/A INTRINSIC
Pfam:HNF_C 374 448 1.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109964
AA Change: M69K

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105590
Gene: ENSMUSG00000037025
AA Change: M69K

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
low complexity region 50 73 N/A INTRINSIC
low complexity region 80 110 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
FH 163 253 4.77e-62 SMART
low complexity region 268 287 N/A INTRINSIC
low complexity region 332 371 N/A INTRINSIC
Pfam:HNF_C 380 454 5.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172928
SMART Domains Protein: ENSMUSP00000134081
Gene: ENSMUSG00000037025

DomainStartEndE-ValueType
FH 13 72 1.94e-12 SMART
low complexity region 87 106 N/A INTRINSIC
low complexity region 151 190 N/A INTRINSIC
Pfam:HNF_C 199 273 4.8e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the forkhead class of DNA-binding proteins. These hepatocyte nuclear factors are transcriptional activators for liver-specific genes such as albumin and transthyretin, and they also interact with chromatin. Similar family members in mice have roles in the regulation of metabolism and in the differentiation of the pancreas and liver. This gene has been linked to sporadic cases of maturity-onset diabetes of the young. Transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Embryos homozygous for targeted null mutations fail to form a distinct node, lack a notochord, and die by embryonic day 10 or 11. Mutants also exhibit defects of somite and neural tube organization, and lack a floor plate and motor neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A T 5: 113,703,781 C92* probably null Het
A830018L16Rik G T 1: 11,545,267 E155* probably null Het
Acaa1a A T 9: 119,349,352 probably null Het
Adcy4 T C 14: 55,771,378 E864G probably null Het
Adcy4 T C 14: 55,778,699 D387G probably damaging Het
Ank1 C T 8: 23,098,939 H574Y probably damaging Het
Arhgef16 C T 4: 154,287,038 E233K probably damaging Het
Arhgef26 A T 3: 62,448,104 Y699F probably benign Het
BB014433 C T 8: 15,042,101 V251M probably damaging Het
Bcan G A 3: 87,994,222 A391V probably benign Het
Bod1l A C 5: 41,816,867 V2368G probably benign Het
Braf A G 6: 39,662,151 V222A probably damaging Het
Cd33 G T 7: 43,533,447 probably benign Het
Cdkl2 T A 5: 92,022,151 K324N probably damaging Het
Celf6 A T 9: 59,602,871 T199S probably damaging Het
Cmtm4 A C 8: 104,355,166 D196E probably benign Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Col1a2 C A 6: 4,535,451 P921H unknown Het
Crmp1 T C 5: 37,242,146 M1T probably null Het
Dnah7a A T 1: 53,504,103 Y2303N probably damaging Het
Dock10 G T 1: 80,574,171 T650K probably benign Het
Fam24a A G 7: 131,336,540 D53G probably benign Het
Gatad2a T A 8: 69,909,935 H601L probably damaging Het
Gimap4 A C 6: 48,690,605 D98A probably damaging Het
Gm14295 G T 2: 176,809,830 R371L possibly damaging Het
Gm5039 A G 12: 88,321,400 F28L probably benign Het
Golim4 G T 3: 75,878,128 A652E probably benign Het
Grid1 A G 14: 35,026,942 I240V probably benign Het
Iqsec3 T A 6: 121,413,313 T400S unknown Het
Itk G A 11: 46,334,908 R539C probably damaging Het
Kdelc1 G T 1: 44,112,764 L322I possibly damaging Het
Kif27 T A 13: 58,326,098 D695V possibly damaging Het
Krt79 T C 15: 101,931,006 probably benign Het
Lama2 C A 10: 27,422,714 V129L possibly damaging Het
Lonrf1 C A 8: 36,229,238 E552D possibly damaging Het
Mpp3 A G 11: 102,000,665 I549T probably benign Het
Nat1 T C 8: 67,491,742 Y260H probably benign Het
Nipal2 T A 15: 34,648,837 K69* probably null Het
Nlrx1 G T 9: 44,256,941 probably benign Het
Pde1b C A 15: 103,521,425 A115E probably benign Het
Pde4dip A G 3: 97,766,494 Y369H probably damaging Het
Pnpla7 A G 2: 25,053,419 Y1286C possibly damaging Het
Pramel5 T C 4: 144,272,959 E186G possibly damaging Het
Qdpr C T 5: 45,450,044 G20D probably damaging Het
Rmnd1 T G 10: 4,407,918 I364L probably benign Het
Slc5a4a A T 10: 76,186,535 E568V probably benign Het
Slc6a18 T A 13: 73,668,271 I330F probably benign Het
Spesp1 T C 9: 62,273,270 T119A possibly damaging Het
Sypl G A 12: 32,975,663 S242N probably benign Het
Tbx18 G A 9: 87,730,717 T43M probably benign Het
Tm7sf2 T A 19: 6,063,926 D263V probably damaging Het
Trbv21 T C 6: 41,202,990 I80T probably damaging Het
Ttc3 T A 16: 94,427,808 L747Q possibly damaging Het
Ttll11 T C 2: 35,817,801 D498G possibly damaging Het
Ttn T C 2: 76,753,370 Y22431C probably null Het
Ubtfl1 T A 9: 18,410,341 S388R Het
Vmn2r118 A T 17: 55,610,835 L226I possibly damaging Het
Wdr46 A G 17: 33,949,182 H576R probably benign Het
Zfp426 A G 9: 20,475,000 F62L probably damaging Het
Other mutations in Foxa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Foxa2 APN 2 148044818 missense possibly damaging 0.93
IGL02560:Foxa2 APN 2 148044031 missense probably benign 0.40
IGL02797:Foxa2 APN 2 148044125 missense possibly damaging 0.95
R6768_Foxa2_027 UTSW 2 148043827 missense probably damaging 0.97
R0116:Foxa2 UTSW 2 148043561 missense probably damaging 0.99
R2252:Foxa2 UTSW 2 148044166 missense probably damaging 0.98
R4334:Foxa2 UTSW 2 148044703 missense possibly damaging 0.85
R5293:Foxa2 UTSW 2 148044002 missense probably benign 0.09
R5339:Foxa2 UTSW 2 148044434 missense probably damaging 1.00
R6768:Foxa2 UTSW 2 148043827 missense probably damaging 0.97
R8036:Foxa2 UTSW 2 148043989 missense probably benign
R8137:Foxa2 UTSW 2 148043848 missense probably benign
R9091:Foxa2 UTSW 2 148044506 missense probably benign 0.05
R9270:Foxa2 UTSW 2 148044506 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCATCGAGTTCATGTTGGCG -3'
(R):5'- CAGAGGCTTGCACGAATTG -3'

Sequencing Primer
(F):5'- ATCGAGTTCATGTTGGCGTAGGG -3'
(R):5'- GACTGGGTCCAACTGGTG -3'
Posted On 2021-10-11