Mutagenetix > Incidental Mutations

Incidental Mutation 'R8993:Arhgef26'

684525

Institutional Source

Beutler Lab

Gene Symbol

Arhgef26

Ensembl Gene

ENSMUSG00000036885

Gene Name

Rho guanine nucleotide exchange factor (GEF) 26

Synonyms

4631416L12Rik, 8430436L14Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.233) question?

Stock #

R8993 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

62338344-62462221 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 62448104 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 699 (Y699F)

Ref Sequence

ENSEMBL: ENSMUSP00000078281 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079300]

AlphaFold

D3YYY8

Predicted Effect

probably benign
Transcript: ENSMUST00000079300
AA Change: Y699F

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000078281
Gene: ENSMUSG00000036885
AA Change: Y699F

Domain	Start	End	E-Value	Type
low complexity region	133	144	N/A	INTRINSIC
low complexity region	392	403	N/A	INTRINSIC
RhoGEF	441	620	1e-45	SMART
PH	654	782	4.04e-9	SMART
SH3	790	847	3.82e-13	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000124392
Gene: ENSMUSG00000036885
AA Change: Y165F

Domain	Start	End	E-Value	Type
Pfam:RhoGEF	2	87	2.3e-19	PFAM
PH	121	249	4.04e-9	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho-guanine nucleotide exchange factor (Rho-GEF) family. These proteins regulate Rho GTPases by catalyzing the exchange of GDP for GTP. The encoded protein specifically activates RhoG and plays a role in the promotion of macropinocytosis. Underexpression of the encoded protein may be a predictive marker of chemoresistant disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defective activation of RhoG and reduced membrane protrusion after ICAM-1 clustering. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700069L16Rik	A	T	5: 113,703,781	C92*	probably null	Het
A830018L16Rik	G	T	1: 11,545,267	E155*	probably null	Het
Acaa1a	A	T	9: 119,349,352		probably null	Het
Adcy4	T	C	14: 55,771,378	E864G	probably null	Het
Adcy4	T	C	14: 55,778,699	D387G	probably damaging	Het
Ank1	C	T	8: 23,098,939	H574Y	probably damaging	Het
Arhgef16	C	T	4: 154,287,038	E233K	probably damaging	Het
BB014433	C	T	8: 15,042,101	V251M	probably damaging	Het
Bcan	G	A	3: 87,994,222	A391V	probably benign	Het
Bod1l	A	C	5: 41,816,867	V2368G	probably benign	Het
Braf	A	G	6: 39,662,151	V222A	probably damaging	Het
Cd33	G	T	7: 43,533,447		probably benign	Het
Cdkl2	T	A	5: 92,022,151	K324N	probably damaging	Het
Celf6	A	T	9: 59,602,871	T199S	probably damaging	Het
Cmtm4	A	C	8: 104,355,166	D196E	probably benign	Het
Cntn1	G	A	15: 92,234,466	V148M	probably damaging	Het
Col1a2	C	A	6: 4,535,451	P921H	unknown	Het
Crmp1	T	C	5: 37,242,146	M1T	probably null	Het
Dnah7a	A	T	1: 53,504,103	Y2303N	probably damaging	Het
Dock10	G	T	1: 80,574,171	T650K	probably benign	Het
Fam24a	A	G	7: 131,336,540	D53G	probably benign	Het
Foxa2	A	T	2: 148,044,706	M69K	probably benign	Het
Gatad2a	T	A	8: 69,909,935	H601L	probably damaging	Het
Gimap4	A	C	6: 48,690,605	D98A	probably damaging	Het
Gm14295	G	T	2: 176,809,830	R371L	possibly damaging	Het
Gm5039	A	G	12: 88,321,400	F28L	probably benign	Het
Golim4	G	T	3: 75,878,128	A652E	probably benign	Het
Grid1	A	G	14: 35,026,942	I240V	probably benign	Het
Iqsec3	T	A	6: 121,413,313	T400S	unknown	Het
Itk	G	A	11: 46,334,908	R539C	probably damaging	Het
Kdelc1	G	T	1: 44,112,764	L322I	possibly damaging	Het
Kif27	T	A	13: 58,326,098	D695V	possibly damaging	Het
Krt79	T	C	15: 101,931,006		probably benign	Het
Lama2	C	A	10: 27,422,714	V129L	possibly damaging	Het
Lonrf1	C	A	8: 36,229,238	E552D	possibly damaging	Het
Mpp3	A	G	11: 102,000,665	I549T	probably benign	Het
Nat1	T	C	8: 67,491,742	Y260H	probably benign	Het
Nipal2	T	A	15: 34,648,837	K69*	probably null	Het
Nlrx1	G	T	9: 44,256,941		probably benign	Het
Pde1b	C	A	15: 103,521,425	A115E	probably benign	Het
Pde4dip	A	G	3: 97,766,494	Y369H	probably damaging	Het
Pnpla7	A	G	2: 25,053,419	Y1286C	possibly damaging	Het
Pramel5	T	C	4: 144,272,959	E186G	possibly damaging	Het
Qdpr	C	T	5: 45,450,044	G20D	probably damaging	Het
Rmnd1	T	G	10: 4,407,918	I364L	probably benign	Het
Slc5a4a	A	T	10: 76,186,535	E568V	probably benign	Het
Slc6a18	T	A	13: 73,668,271	I330F	probably benign	Het
Spesp1	T	C	9: 62,273,270	T119A	possibly damaging	Het
Sypl	G	A	12: 32,975,663	S242N	probably benign	Het
Tbx18	G	A	9: 87,730,717	T43M	probably benign	Het
Tm7sf2	T	A	19: 6,063,926	D263V	probably damaging	Het
Trbv21	T	C	6: 41,202,990	I80T	probably damaging	Het
Ttc3	T	A	16: 94,427,808	L747Q	possibly damaging	Het
Ttll11	T	C	2: 35,817,801	D498G	possibly damaging	Het
Ttn	T	C	2: 76,753,370	Y22431C	probably null	Het
Ubtfl1	T	A	9: 18,410,341	S388R		Het
Vmn2r118	A	T	17: 55,610,835	L226I	possibly damaging	Het
Wdr46	A	G	17: 33,949,182	H576R	probably benign	Het
Zfp426	A	G	9: 20,475,000	F62L	probably damaging	Het

Other mutations in Arhgef26

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Arhgef26	APN	3	62340383	missense	probably benign
IGL01060:Arhgef26	APN	3	62340121	missense	probably benign	0.44
IGL01942:Arhgef26	APN	3	62340094	missense	probably benign	0.03
IGL02085:Arhgef26	APN	3	62459724	intron	probably benign
IGL02172:Arhgef26	APN	3	62459676	missense	probably benign	0.03
IGL03017:Arhgef26	APN	3	62448281	missense	possibly damaging	0.46
IGL03101:Arhgef26	APN	3	62419661	missense	possibly damaging	0.95
IGL03296:Arhgef26	APN	3	62423505	missense	probably damaging	1.00
IGL03401:Arhgef26	APN	3	62423532	missense	possibly damaging	0.95
R0138:Arhgef26	UTSW	3	62448259	missense	probably benign	0.06
R0140:Arhgef26	UTSW	3	62448245	missense	probably benign	0.02
R0152:Arhgef26	UTSW	3	62423544	missense	probably damaging	0.99
R0157:Arhgef26	UTSW	3	62380971	missense	probably damaging	1.00
R0308:Arhgef26	UTSW	3	62340399	missense	probably benign	0.01
R0317:Arhgef26	UTSW	3	62423544	missense	probably damaging	0.99
R0529:Arhgef26	UTSW	3	62339725	missense	probably benign
R0825:Arhgef26	UTSW	3	62426593	missense	probably damaging	0.97
R1331:Arhgef26	UTSW	3	62340028	missense	probably benign	0.00
R1333:Arhgef26	UTSW	3	62340323	missense	probably benign	0.04
R1351:Arhgef26	UTSW	3	62380841	missense	probably damaging	1.00
R1740:Arhgef26	UTSW	3	62423583	missense	probably damaging	1.00
R2121:Arhgef26	UTSW	3	62340283	missense	probably damaging	0.96
R2404:Arhgef26	UTSW	3	62428915	missense	possibly damaging	0.90
R2437:Arhgef26	UTSW	3	62432581	missense	probably damaging	0.96
R2939:Arhgef26	UTSW	3	62380910	missense	possibly damaging	0.72
R3084:Arhgef26	UTSW	3	62377616	missense	probably benign	0.19
R3712:Arhgef26	UTSW	3	62423629	missense	probably damaging	1.00
R4005:Arhgef26	UTSW	3	62340395	missense	probably benign
R4225:Arhgef26	UTSW	3	62380922	missense	probably benign	0.00
R4635:Arhgef26	UTSW	3	62340440	missense	probably damaging	1.00
R4961:Arhgef26	UTSW	3	62459625	missense	probably damaging	1.00
R4989:Arhgef26	UTSW	3	62340385	missense	possibly damaging	0.94
R5249:Arhgef26	UTSW	3	62340560	missense	probably damaging	1.00
R5284:Arhgef26	UTSW	3	62419631	missense	probably damaging	0.99
R5661:Arhgef26	UTSW	3	62377654	splice site	probably benign
R5970:Arhgef26	UTSW	3	62340047	missense	probably benign
R6022:Arhgef26	UTSW	3	62428939	missense	probably damaging	1.00
R6193:Arhgef26	UTSW	3	62339792	missense	possibly damaging	0.49
R6247:Arhgef26	UTSW	3	62380960	missense	probably damaging	1.00
R6434:Arhgef26	UTSW	3	62428914	missense	probably damaging	0.99
R6827:Arhgef26	UTSW	3	62423498	splice site	probably null
R7111:Arhgef26	UTSW	3	62345268	missense	possibly damaging	0.90
R7128:Arhgef26	UTSW	3	62419550	missense	possibly damaging	0.94
R7360:Arhgef26	UTSW	3	62448205	missense	possibly damaging	0.63
R7456:Arhgef26	UTSW	3	62340055	missense	probably benign	0.00
R8039:Arhgef26	UTSW	3	62339930	missense	probably benign	0.32
R8120:Arhgef26	UTSW	3	62341375	missense	probably damaging	1.00
R8511:Arhgef26	UTSW	3	62428929	missense	probably damaging	0.98
R8887:Arhgef26	UTSW	3	62339980	missense	probably benign	0.04
R8979:Arhgef26	UTSW	3	62339548	missense	possibly damaging	0.78
R9213:Arhgef26	UTSW	3	62432579	missense	probably benign	0.03
R9269:Arhgef26	UTSW	3	62340499	missense	probably damaging	0.98
Z1177:Arhgef26	UTSW	3	62339930	missense	probably benign	0.32

Predicted Primers

PCR Primer
(F):5'- GTTTTGTACTCAAGAAGTGCTCAC -3'
(R):5'- TCAGCGCCTAGTAGCATGTC -3'

Sequencing Primer
(F):5'- GCTCTTTTATCTGAGACGTACTTTAG -3'
(R):5'- AGTAGCATGTCCACCTTCTCACTG -3'

Posted On

2021-10-11