Incidental Mutation 'R8993:Pramel5'
ID684529
Institutional Source Beutler Lab
Gene Symbol Pramel5
Ensembl Gene ENSMUSG00000036749
Gene Namepreferentially expressed antigen in melanoma like 5
SynonymsOTTMUSG00000010540
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R8993 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location144270633-144280488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144272959 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 186 (E186G)
Ref Sequence ENSEMBL: ENSMUSP00000044222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035757] [ENSMUST00000105752]
AlphaFold Q7TPY4
Predicted Effect possibly damaging
Transcript: ENSMUST00000035757
AA Change: E186G

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044222
Gene: ENSMUSG00000036749
AA Change: E186G

DomainStartEndE-ValueType
SCOP:d1a4ya_ 224 411 1e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105752
AA Change: E186G

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101378
Gene: ENSMUSG00000036749
AA Change: E186G

DomainStartEndE-ValueType
SCOP:d1a4ya_ 224 411 1e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A T 5: 113,703,781 C92* probably null Het
A830018L16Rik G T 1: 11,545,267 E155* probably null Het
Acaa1a A T 9: 119,349,352 probably null Het
Adcy4 T C 14: 55,771,378 E864G probably null Het
Adcy4 T C 14: 55,778,699 D387G probably damaging Het
Ank1 C T 8: 23,098,939 H574Y probably damaging Het
Arhgef16 C T 4: 154,287,038 E233K probably damaging Het
Arhgef26 A T 3: 62,448,104 Y699F probably benign Het
BB014433 C T 8: 15,042,101 V251M probably damaging Het
Bcan G A 3: 87,994,222 A391V probably benign Het
Bod1l A C 5: 41,816,867 V2368G probably benign Het
Braf A G 6: 39,662,151 V222A probably damaging Het
Cd33 G T 7: 43,533,447 probably benign Het
Cdkl2 T A 5: 92,022,151 K324N probably damaging Het
Celf6 A T 9: 59,602,871 T199S probably damaging Het
Cmtm4 A C 8: 104,355,166 D196E probably benign Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Col1a2 C A 6: 4,535,451 P921H unknown Het
Crmp1 T C 5: 37,242,146 M1T probably null Het
Dnah7a A T 1: 53,504,103 Y2303N probably damaging Het
Dock10 G T 1: 80,574,171 T650K probably benign Het
Fam24a A G 7: 131,336,540 D53G probably benign Het
Foxa2 A T 2: 148,044,706 M69K probably benign Het
Gatad2a T A 8: 69,909,935 H601L probably damaging Het
Gimap4 A C 6: 48,690,605 D98A probably damaging Het
Gm14295 G T 2: 176,809,830 R371L possibly damaging Het
Gm5039 A G 12: 88,321,400 F28L probably benign Het
Golim4 G T 3: 75,878,128 A652E probably benign Het
Grid1 A G 14: 35,026,942 I240V probably benign Het
Iqsec3 T A 6: 121,413,313 T400S unknown Het
Itk G A 11: 46,334,908 R539C probably damaging Het
Kdelc1 G T 1: 44,112,764 L322I possibly damaging Het
Kif27 T A 13: 58,326,098 D695V possibly damaging Het
Lama2 C A 10: 27,422,714 V129L possibly damaging Het
Lonrf1 C A 8: 36,229,238 E552D possibly damaging Het
Mpp3 A G 11: 102,000,665 I549T probably benign Het
Nat1 T C 8: 67,491,742 Y260H probably benign Het
Nipal2 T A 15: 34,648,837 K69* probably null Het
Pde1b C A 15: 103,521,425 A115E probably benign Het
Pde4dip A G 3: 97,766,494 Y369H probably damaging Het
Pnpla7 A G 2: 25,053,419 Y1286C possibly damaging Het
Qdpr C T 5: 45,450,044 G20D probably damaging Het
Rmnd1 T G 10: 4,407,918 I364L probably benign Het
Slc5a4a A T 10: 76,186,535 E568V probably benign Het
Slc6a18 T A 13: 73,668,271 I330F probably benign Het
Spesp1 T C 9: 62,273,270 T119A possibly damaging Het
Sypl G A 12: 32,975,663 S242N probably benign Het
Tbx18 G A 9: 87,730,717 T43M probably benign Het
Tm7sf2 T A 19: 6,063,926 D263V probably damaging Het
Trbv21 T C 6: 41,202,990 I80T probably damaging Het
Ttc3 T A 16: 94,427,808 L747Q possibly damaging Het
Ttll11 T C 2: 35,817,801 D498G possibly damaging Het
Ttn T C 2: 76,753,370 Y22431C probably null Het
Ubtfl1 T A 9: 18,410,341 S388R Het
Vmn2r118 A T 17: 55,610,835 L226I possibly damaging Het
Wdr46 A G 17: 33,949,182 H576R probably benign Het
Zfp426 A G 9: 20,475,000 F62L probably damaging Het
Other mutations in Pramel5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Pramel5 APN 4 144271621 missense probably damaging 1.00
IGL00990:Pramel5 APN 4 144273979 missense probably damaging 1.00
IGL01070:Pramel5 APN 4 144271272 missense probably damaging 1.00
IGL01298:Pramel5 APN 4 144271162 utr 3 prime probably benign
IGL01653:Pramel5 APN 4 144273859 missense probably benign 0.01
IGL02150:Pramel5 APN 4 144273201 missense possibly damaging 0.93
IGL02278:Pramel5 APN 4 144271551 missense probably damaging 1.00
IGL02671:Pramel5 APN 4 144273112 missense probably benign 0.25
IGL02868:Pramel5 APN 4 144271352 missense probably benign 0.03
IGL02981:Pramel5 APN 4 144272860 missense probably benign 0.01
R0532:Pramel5 UTSW 4 144272740 missense probably benign 0.03
R0646:Pramel5 UTSW 4 144271620 missense probably damaging 1.00
R1328:Pramel5 UTSW 4 144271488 missense probably damaging 1.00
R1902:Pramel5 UTSW 4 144273863 nonsense probably null
R2027:Pramel5 UTSW 4 144271704 missense probably damaging 1.00
R2240:Pramel5 UTSW 4 144272936 nonsense probably null
R2439:Pramel5 UTSW 4 144273740 missense probably benign 0.01
R3922:Pramel5 UTSW 4 144273052 missense probably damaging 1.00
R4470:Pramel5 UTSW 4 144271345 missense possibly damaging 0.89
R4808:Pramel5 UTSW 4 144272755 missense probably benign 0.04
R4969:Pramel5 UTSW 4 144271617 missense probably damaging 1.00
R5195:Pramel5 UTSW 4 144271741 missense probably benign 0.01
R5198:Pramel5 UTSW 4 144273494 intron probably benign
R5930:Pramel5 UTSW 4 144272983 missense probably benign 0.43
R5988:Pramel5 UTSW 4 144273146 missense possibly damaging 0.46
R6662:Pramel5 UTSW 4 144273105 missense probably benign 0.32
R6988:Pramel5 UTSW 4 144274007 start gained probably benign
R7116:Pramel5 UTSW 4 144273881 missense possibly damaging 0.94
R7638:Pramel5 UTSW 4 144271440 missense possibly damaging 0.93
R8247:Pramel5 UTSW 4 144272825 missense probably damaging 1.00
R9049:Pramel5 UTSW 4 144273916 missense probably benign 0.02
X0028:Pramel5 UTSW 4 144272836 missense probably benign 0.00
Z1176:Pramel5 UTSW 4 144273860 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCTGTAGGTCTGCAAGGTC -3'
(R):5'- TTCATGAAGTCTGCTCTCAAGATG -3'

Sequencing Primer
(F):5'- TCTGCAAGGTCAGGAGGTCTC -3'
(R):5'- CTCTCAAGATGTCTTTGGCAAGAACC -3'
Posted On2021-10-11