Incidental Mutation 'R8993:Crmp1'
ID 684531
Institutional Source Beutler Lab
Gene Symbol Crmp1
Ensembl Gene ENSMUSG00000029121
Gene Name collapsin response mediator protein 1
Synonyms Ulip3, DRP-1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock # R8993 (G1)
Quality Score 113.008
Status Validated
Chromosome 5
Chromosomal Location 37241940-37292133 bp(+) (GRCm38)
Type of Mutation start codon destroyed
DNA Base Change (assembly) T to C at 37242146 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000109795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031004] [ENSMUST00000114158] [ENSMUST00000201834] [ENSMUST00000202434]
AlphaFold P97427
Predicted Effect probably benign
Transcript: ENSMUST00000031004
SMART Domains Protein: ENSMUSP00000031004
Gene: ENSMUSG00000029121

DomainStartEndE-ValueType
Pfam:Amidohydro_1 64 453 9.1e-35 PFAM
Pfam:Amidohydro_3 333 454 8.5e-10 PFAM
low complexity region 507 530 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114158
AA Change: M1T

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109795
Gene: ENSMUSG00000029121
AA Change: M1T

DomainStartEndE-ValueType
Pfam:Amidohydro_1 178 567 5.2e-34 PFAM
Pfam:Amidohydro_3 448 568 2.8e-10 PFAM
low complexity region 621 644 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201834
SMART Domains Protein: ENSMUSP00000144408
Gene: ENSMUSG00000029121

DomainStartEndE-ValueType
Pfam:Amidohydro_1 1 143 3.6e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000202434
AA Change: M1T

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143847
Gene: ENSMUSG00000029121
AA Change: M1T

DomainStartEndE-ValueType
PDB:1KCX|B 128 191 3e-36 PDB
SCOP:d1gkpa1 131 190 2e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This gene encodes a protein that is part of the collapsin response mediator protein family. The family is comprised of five, homologous cytosolic phosphoproteins that are expressed in developing and adult nervous tissue and mediate signaling to transduce responses to extracellular cues. This protein is a Semaphorin 3A signaling molecule that regulates collapse of the growth cone. The growth cone mediates axonal pathfinding in neurons. This protein is reported to represent a new class of microtubule-associated proteins. In humans this protein is reported to inhibit cancer cell invasion. In mouse deficiency of this gene may be associated with impaired spatial memory performance. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for one knock-out allele show transient postnatal changes in granule cell proliferation, apoptosis and migration in cerebellum and delayed radial migration of cortical neurons in cerebral cortex. Homozygotes for another knock-out allele show reduced LTP and impaired spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A T 5: 113,703,781 C92* probably null Het
A830018L16Rik G T 1: 11,545,267 E155* probably null Het
Acaa1a A T 9: 119,349,352 probably null Het
Adcy4 T C 14: 55,771,378 E864G probably null Het
Adcy4 T C 14: 55,778,699 D387G probably damaging Het
Ank1 C T 8: 23,098,939 H574Y probably damaging Het
Arhgef16 C T 4: 154,287,038 E233K probably damaging Het
Arhgef26 A T 3: 62,448,104 Y699F probably benign Het
BB014433 C T 8: 15,042,101 V251M probably damaging Het
Bcan G A 3: 87,994,222 A391V probably benign Het
Bod1l A C 5: 41,816,867 V2368G probably benign Het
Braf A G 6: 39,662,151 V222A probably damaging Het
Cd33 G T 7: 43,533,447 probably benign Het
Cdkl2 T A 5: 92,022,151 K324N probably damaging Het
Celf6 A T 9: 59,602,871 T199S probably damaging Het
Cmtm4 A C 8: 104,355,166 D196E probably benign Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Col1a2 C A 6: 4,535,451 P921H unknown Het
Dnah7a A T 1: 53,504,103 Y2303N probably damaging Het
Dock10 G T 1: 80,574,171 T650K probably benign Het
Fam24a A G 7: 131,336,540 D53G probably benign Het
Foxa2 A T 2: 148,044,706 M69K probably benign Het
Gatad2a T A 8: 69,909,935 H601L probably damaging Het
Gimap4 A C 6: 48,690,605 D98A probably damaging Het
Gm14295 G T 2: 176,809,830 R371L possibly damaging Het
Gm5039 A G 12: 88,321,400 F28L probably benign Het
Golim4 G T 3: 75,878,128 A652E probably benign Het
Grid1 A G 14: 35,026,942 I240V probably benign Het
Iqsec3 T A 6: 121,413,313 T400S unknown Het
Itk G A 11: 46,334,908 R539C probably damaging Het
Kdelc1 G T 1: 44,112,764 L322I possibly damaging Het
Kif27 T A 13: 58,326,098 D695V possibly damaging Het
Krt79 T C 15: 101,931,006 probably benign Het
Lama2 C A 10: 27,422,714 V129L possibly damaging Het
Lonrf1 C A 8: 36,229,238 E552D possibly damaging Het
Mpp3 A G 11: 102,000,665 I549T probably benign Het
Nat1 T C 8: 67,491,742 Y260H probably benign Het
Nipal2 T A 15: 34,648,837 K69* probably null Het
Nlrx1 G T 9: 44,256,941 probably benign Het
Pde1b C A 15: 103,521,425 A115E probably benign Het
Pde4dip A G 3: 97,766,494 Y369H probably damaging Het
Pnpla7 A G 2: 25,053,419 Y1286C possibly damaging Het
Pramel5 T C 4: 144,272,959 E186G possibly damaging Het
Qdpr C T 5: 45,450,044 G20D probably damaging Het
Rmnd1 T G 10: 4,407,918 I364L probably benign Het
Slc5a4a A T 10: 76,186,535 E568V probably benign Het
Slc6a18 T A 13: 73,668,271 I330F probably benign Het
Spesp1 T C 9: 62,273,270 T119A possibly damaging Het
Sypl G A 12: 32,975,663 S242N probably benign Het
Tbx18 G A 9: 87,730,717 T43M probably benign Het
Tm7sf2 T A 19: 6,063,926 D263V probably damaging Het
Trbv21 T C 6: 41,202,990 I80T probably damaging Het
Ttc3 T A 16: 94,427,808 L747Q possibly damaging Het
Ttll11 T C 2: 35,817,801 D498G possibly damaging Het
Ttn T C 2: 76,753,370 Y22431C probably null Het
Ubtfl1 T A 9: 18,410,341 S388R Het
Vmn2r118 A T 17: 55,610,835 L226I possibly damaging Het
Wdr46 A G 17: 33,949,182 H576R probably benign Het
Zfp426 A G 9: 20,475,000 F62L probably damaging Het
Other mutations in Crmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Crmp1 APN 5 37276313 missense probably damaging 0.99
IGL02506:Crmp1 APN 5 37278855 splice site probably benign
IGL02904:Crmp1 APN 5 37288918 missense possibly damaging 0.80
IGL02946:Crmp1 APN 5 37284080 missense probably damaging 1.00
IGL02981:Crmp1 APN 5 37286426 missense probably damaging 0.97
IGL03068:Crmp1 APN 5 37265289 missense possibly damaging 0.69
R0049:Crmp1 UTSW 5 37265273 missense possibly damaging 0.52
R0049:Crmp1 UTSW 5 37265273 missense possibly damaging 0.52
R0105:Crmp1 UTSW 5 37284135 missense probably damaging 1.00
R0105:Crmp1 UTSW 5 37284135 missense probably damaging 1.00
R0331:Crmp1 UTSW 5 37265313 missense possibly damaging 0.79
R1226:Crmp1 UTSW 5 37273434 missense probably damaging 1.00
R1372:Crmp1 UTSW 5 37288811 missense probably benign 0.14
R1651:Crmp1 UTSW 5 37273439 missense probably damaging 0.97
R1653:Crmp1 UTSW 5 37286468 missense probably damaging 1.00
R1951:Crmp1 UTSW 5 37273355 missense possibly damaging 0.81
R1977:Crmp1 UTSW 5 37276283 missense probably damaging 1.00
R2107:Crmp1 UTSW 5 37242494 missense probably benign 0.04
R2295:Crmp1 UTSW 5 37265262 missense probably benign
R2495:Crmp1 UTSW 5 37246097 critical splice donor site probably null
R3417:Crmp1 UTSW 5 37268687 missense possibly damaging 0.48
R3788:Crmp1 UTSW 5 37284140 missense probably damaging 1.00
R4490:Crmp1 UTSW 5 37276331 missense probably damaging 0.99
R5338:Crmp1 UTSW 5 37279674 missense probably benign 0.16
R5592:Crmp1 UTSW 5 37265265 missense probably benign 0.09
R5761:Crmp1 UTSW 5 37282868 missense probably benign 0.15
R6243:Crmp1 UTSW 5 37288944 missense probably damaging 1.00
R6726:Crmp1 UTSW 5 37284064 missense probably benign 0.04
R6750:Crmp1 UTSW 5 37265322 critical splice donor site probably null
R7013:Crmp1 UTSW 5 37268692 splice site probably null
R7183:Crmp1 UTSW 5 37288817 missense probably benign 0.01
R7360:Crmp1 UTSW 5 37276280 missense possibly damaging 0.95
R7419:Crmp1 UTSW 5 37278885 missense probably benign 0.03
R7792:Crmp1 UTSW 5 37284095 missense probably damaging 1.00
R8427:Crmp1 UTSW 5 37291195 missense probably damaging 1.00
R8479:Crmp1 UTSW 5 37284158 missense possibly damaging 0.59
R8762:Crmp1 UTSW 5 37284096 missense probably damaging 1.00
R9027:Crmp1 UTSW 5 37280603 nonsense probably null
Z1177:Crmp1 UTSW 5 37278124 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTTTGTGAGGTGAAGCTTAACC -3'
(R):5'- ACATCACTGGCCGTGTCTTC -3'

Sequencing Primer
(F):5'- AGGTGAAGCTTAACCGTGTGTAC -3'
(R):5'- CCGTGTCTTCGCTGCCG -3'
Posted On 2021-10-11