Mutagenetix > Incidental Mutations

Incidental Mutation 'R8993:Bod1l'

684532

Institutional Source

Beutler Lab

Gene Symbol

Bod1l

Ensembl Gene

ENSMUSG00000061755

Gene Name

biorientation of chromosomes in cell division 1-like

Synonyms

A230054D04Rik

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.950) question?

Stock #

R8993 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

41787538-41844315 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 41816867 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 2368 (V2368G)

Ref Sequence

ENSEMBL: ENSMUSP00000058618 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050556] [ENSMUST00000202908]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000050556
AA Change: V2368G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000058618
Gene: ENSMUSG00000061755
AA Change: V2368G

Domain	Start	End	E-Value	Type
low complexity region	5	47	N/A	INTRINSIC
Pfam:COMPASS-Shg1	54	150	1.8e-28	PFAM
low complexity region	328	343	N/A	INTRINSIC
low complexity region	415	435	N/A	INTRINSIC
low complexity region	475	484	N/A	INTRINSIC
coiled coil region	495	520	N/A	INTRINSIC
coiled coil region	553	580	N/A	INTRINSIC
low complexity region	820	840	N/A	INTRINSIC
low complexity region	895	916	N/A	INTRINSIC
low complexity region	996	1005	N/A	INTRINSIC
low complexity region	1023	1041	N/A	INTRINSIC
low complexity region	1272	1286	N/A	INTRINSIC
low complexity region	1791	1809	N/A	INTRINSIC
low complexity region	2695	2701	N/A	INTRINSIC
low complexity region	2711	2729	N/A	INTRINSIC
AT_hook	2807	2819	3.21e-1	SMART
coiled coil region	2908	2929	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202908
AA Change: V2368G

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000144359
Gene: ENSMUSG00000061755
AA Change: V2368G

Domain	Start	End	E-Value	Type
low complexity region	5	47	N/A	INTRINSIC
Pfam:COMPASS-Shg1	54	150	2.9e-24	PFAM
low complexity region	328	343	N/A	INTRINSIC
low complexity region	415	435	N/A	INTRINSIC
low complexity region	475	484	N/A	INTRINSIC
coiled coil region	495	520	N/A	INTRINSIC
coiled coil region	553	580	N/A	INTRINSIC
low complexity region	820	840	N/A	INTRINSIC
low complexity region	895	916	N/A	INTRINSIC
low complexity region	996	1005	N/A	INTRINSIC
low complexity region	1023	1041	N/A	INTRINSIC
low complexity region	1272	1286	N/A	INTRINSIC
low complexity region	1791	1809	N/A	INTRINSIC
low complexity region	2695	2701	N/A	INTRINSIC
low complexity region	2711	2729	N/A	INTRINSIC
AT_hook	2807	2819	1.9e-3	SMART
coiled coil region	2908	2929	N/A	INTRINSIC

Meta Mutation Damage Score

0.0658

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (56/56)

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700069L16Rik	A	T	5: 113,703,781	C92*	probably null	Het
A830018L16Rik	G	T	1: 11,545,267	E155*	probably null	Het
Acaa1a	A	T	9: 119,349,352		probably null	Het
Adcy4	T	C	14: 55,771,378	E864G	probably null	Het
Adcy4	T	C	14: 55,778,699	D387G	probably damaging	Het
Ank1	C	T	8: 23,098,939	H574Y	probably damaging	Het
Arhgef16	C	T	4: 154,287,038	E233K	probably damaging	Het
Arhgef26	A	T	3: 62,448,104	Y699F	probably benign	Het
BB014433	C	T	8: 15,042,101	V251M	probably damaging	Het
Bcan	G	A	3: 87,994,222	A391V	probably benign	Het
Braf	A	G	6: 39,662,151	V222A	probably damaging	Het
Cd33	G	T	7: 43,533,447		probably benign	Het
Cdkl2	T	A	5: 92,022,151	K324N	probably damaging	Het
Celf6	A	T	9: 59,602,871	T199S	probably damaging	Het
Cmtm4	A	C	8: 104,355,166	D196E	probably benign	Het
Cntn1	G	A	15: 92,234,466	V148M	probably damaging	Het
Col1a2	C	A	6: 4,535,451	P921H	unknown	Het
Crmp1	T	C	5: 37,242,146	M1T	probably null	Het
Dnah7a	A	T	1: 53,504,103	Y2303N	probably damaging	Het
Dock10	G	T	1: 80,574,171	T650K	probably benign	Het
Fam24a	A	G	7: 131,336,540	D53G	probably benign	Het
Foxa2	A	T	2: 148,044,706	M69K	probably benign	Het
Gatad2a	T	A	8: 69,909,935	H601L	probably damaging	Het
Gimap4	A	C	6: 48,690,605	D98A	probably damaging	Het
Gm14295	G	T	2: 176,809,830	R371L	possibly damaging	Het
Gm5039	A	G	12: 88,321,400	F28L	probably benign	Het
Golim4	G	T	3: 75,878,128	A652E	probably benign	Het
Grid1	A	G	14: 35,026,942	I240V	probably benign	Het
Iqsec3	T	A	6: 121,413,313	T400S	unknown	Het
Itk	G	A	11: 46,334,908	R539C	probably damaging	Het
Kdelc1	G	T	1: 44,112,764	L322I	possibly damaging	Het
Kif27	T	A	13: 58,326,098	D695V	possibly damaging	Het
Krt79	T	C	15: 101,931,006		probably benign	Het
Lama2	C	A	10: 27,422,714	V129L	possibly damaging	Het
Lonrf1	C	A	8: 36,229,238	E552D	possibly damaging	Het
Mpp3	A	G	11: 102,000,665	I549T	probably benign	Het
Nat1	T	C	8: 67,491,742	Y260H	probably benign	Het
Nipal2	T	A	15: 34,648,837	K69*	probably null	Het
Nlrx1	G	T	9: 44,256,941		probably benign	Het
Pde1b	C	A	15: 103,521,425	A115E	probably benign	Het
Pde4dip	A	G	3: 97,766,494	Y369H	probably damaging	Het
Pnpla7	A	G	2: 25,053,419	Y1286C	possibly damaging	Het
Pramel5	T	C	4: 144,272,959	E186G	possibly damaging	Het
Qdpr	C	T	5: 45,450,044	G20D	probably damaging	Het
Rmnd1	T	G	10: 4,407,918	I364L	probably benign	Het
Slc5a4a	A	T	10: 76,186,535	E568V	probably benign	Het
Slc6a18	T	A	13: 73,668,271	I330F	probably benign	Het
Spesp1	T	C	9: 62,273,270	T119A	possibly damaging	Het
Sypl	G	A	12: 32,975,663	S242N	probably benign	Het
Tbx18	G	A	9: 87,730,717	T43M	probably benign	Het
Tm7sf2	T	A	19: 6,063,926	D263V	probably damaging	Het
Trbv21	T	C	6: 41,202,990	I80T	probably damaging	Het
Ttc3	T	A	16: 94,427,808	L747Q	possibly damaging	Het
Ttll11	T	C	2: 35,817,801	D498G	possibly damaging	Het
Ttn	T	C	2: 76,753,370	Y22431C	probably null	Het
Ubtfl1	T	A	9: 18,410,341	S388R		Het
Vmn2r118	A	T	17: 55,610,835	L226I	possibly damaging	Het
Wdr46	A	G	17: 33,949,182	H576R	probably benign	Het
Zfp426	A	G	9: 20,475,000	F62L	probably damaging	Het

Other mutations in Bod1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00944:Bod1l	APN	5	41816823	missense	probably benign	0.00
IGL00990:Bod1l	APN	5	41828865	missense	probably benign	0.00
IGL01021:Bod1l	APN	5	41838173	splice site	probably benign
IGL01022:Bod1l	APN	5	41794309	missense	probably damaging	1.00
IGL01303:Bod1l	APN	5	41817599	missense	probably benign	0.00
IGL01654:Bod1l	APN	5	41818176	missense	probably damaging	0.99
IGL01748:Bod1l	APN	5	41816961	missense	probably benign	0.23
IGL01758:Bod1l	APN	5	41826610	splice site	probably benign
IGL01783:Bod1l	APN	5	41808712	missense	probably benign	0.02
IGL01790:Bod1l	APN	5	41832250	missense	probably benign	0.14
IGL01803:Bod1l	APN	5	41817389	missense	probably damaging	0.97
IGL01829:Bod1l	APN	5	41820468	missense	probably benign	0.25
IGL01952:Bod1l	APN	5	41816954	missense	possibly damaging	0.70
IGL02005:Bod1l	APN	5	41816339	missense	probably benign	0.01
IGL02110:Bod1l	APN	5	41816453	missense	probably damaging	0.97
IGL02129:Bod1l	APN	5	41821850	missense	probably benign	0.36
IGL02572:Bod1l	APN	5	41821230	nonsense	probably null
IGL02583:Bod1l	APN	5	41816207	critical splice donor site	probably null
IGL02643:Bod1l	APN	5	41818805	missense	possibly damaging	0.65
IGL02714:Bod1l	APN	5	41816339	missense	probably benign	0.01
IGL02728:Bod1l	APN	5	41826503	missense	probably damaging	1.00
IGL02752:Bod1l	APN	5	41816463	missense	possibly damaging	0.58
IGL02822:Bod1l	APN	5	41794345	missense	possibly damaging	0.94
IGL03032:Bod1l	APN	5	41831584	missense	probably benign	0.16
IGL03372:Bod1l	APN	5	41805235	splice site	probably benign
gauss	UTSW	5	41816867	missense	probably benign	0.01
Tesla	UTSW	5	41795068	critical splice donor site	probably null
R0102:Bod1l	UTSW	5	41817269	missense	probably benign	0.36
R0147:Bod1l	UTSW	5	41818697	missense	possibly damaging	0.48
R0148:Bod1l	UTSW	5	41818697	missense	possibly damaging	0.48
R0490:Bod1l	UTSW	5	41821892	missense	probably damaging	0.96
R0577:Bod1l	UTSW	5	41794887	missense	probably damaging	1.00
R0587:Bod1l	UTSW	5	41821637	missense	probably benign	0.16
R0620:Bod1l	UTSW	5	41801233	missense	probably benign	0.16
R0626:Bod1l	UTSW	5	41831537	missense	probably damaging	1.00
R0785:Bod1l	UTSW	5	41820016	missense	probably benign	0.00
R1139:Bod1l	UTSW	5	41831471	missense	possibly damaging	0.64
R1165:Bod1l	UTSW	5	41821053	missense	probably benign	0.02
R1418:Bod1l	UTSW	5	41819471	missense	probably damaging	1.00
R1509:Bod1l	UTSW	5	41819540	missense	probably damaging	0.99
R1533:Bod1l	UTSW	5	41822155	nonsense	probably null
R1538:Bod1l	UTSW	5	41816429	missense	probably benign	0.00
R1591:Bod1l	UTSW	5	41819220	missense	probably benign	0.06
R1616:Bod1l	UTSW	5	41808715	missense	probably benign
R1628:Bod1l	UTSW	5	41816982	missense	probably benign	0.01
R1667:Bod1l	UTSW	5	41816775	missense	probably benign	0.01
R1869:Bod1l	UTSW	5	41833675	missense	possibly damaging	0.93
R1870:Bod1l	UTSW	5	41833675	missense	possibly damaging	0.93
R1993:Bod1l	UTSW	5	41817336	missense	probably damaging	1.00
R2060:Bod1l	UTSW	5	41808742	missense	possibly damaging	0.58
R2066:Bod1l	UTSW	5	41805156	missense	probably damaging	0.99
R2067:Bod1l	UTSW	5	41817086	missense	probably benign	0.11
R2073:Bod1l	UTSW	5	41819189	missense	probably benign	0.19
R2092:Bod1l	UTSW	5	41831517	missense	probably damaging	1.00
R2105:Bod1l	UTSW	5	41832279	missense	probably benign	0.00
R2243:Bod1l	UTSW	5	41821545	missense	possibly damaging	0.58
R2322:Bod1l	UTSW	5	41827120	missense	probably benign	0.09
R2849:Bod1l	UTSW	5	41838076	missense	probably damaging	1.00
R2883:Bod1l	UTSW	5	41832259	missense	probably benign	0.03
R3037:Bod1l	UTSW	5	41822037	missense	probably damaging	0.99
R3910:Bod1l	UTSW	5	41817098	missense	probably damaging	0.99
R3911:Bod1l	UTSW	5	41817098	missense	probably damaging	0.99
R3962:Bod1l	UTSW	5	41808721	missense	probably benign	0.07
R4235:Bod1l	UTSW	5	41821455	missense	probably damaging	1.00
R4308:Bod1l	UTSW	5	41791813	missense	possibly damaging	0.91
R4414:Bod1l	UTSW	5	41820527	missense	probably benign	0.04
R4535:Bod1l	UTSW	5	41832231	missense	probably benign	0.06
R4631:Bod1l	UTSW	5	41817735	missense	probably damaging	1.00
R4657:Bod1l	UTSW	5	41818612	missense	probably benign	0.00
R4782:Bod1l	UTSW	5	41833663	missense	probably benign	0.06
R4786:Bod1l	UTSW	5	41819438	missense	probably benign	0.43
R4840:Bod1l	UTSW	5	41818472	missense	probably damaging	1.00
R4877:Bod1l	UTSW	5	41819994	missense	probably benign	0.00
R4982:Bod1l	UTSW	5	41820473	missense	probably benign	0.00
R5152:Bod1l	UTSW	5	41816543	missense	probably benign	0.04
R5284:Bod1l	UTSW	5	41820467	missense	probably benign	0.05
R5354:Bod1l	UTSW	5	41831537	missense	probably damaging	1.00
R5369:Bod1l	UTSW	5	41827183	missense	probably damaging	1.00
R5486:Bod1l	UTSW	5	41807181	missense	possibly damaging	0.56
R5541:Bod1l	UTSW	5	41791933	missense	probably benign	0.06
R5610:Bod1l	UTSW	5	41821874	missense	probably damaging	1.00
R5655:Bod1l	UTSW	5	41817044	missense	probably benign	0.06
R5705:Bod1l	UTSW	5	41817002	missense	probably benign	0.01
R5819:Bod1l	UTSW	5	41832605	missense	probably benign	0.27
R5890:Bod1l	UTSW	5	41820578	missense	probably benign	0.43
R5923:Bod1l	UTSW	5	41817419	missense	probably damaging	1.00
R5991:Bod1l	UTSW	5	41816863	nonsense	probably null
R6017:Bod1l	UTSW	5	41818760	missense	probably benign	0.01
R6253:Bod1l	UTSW	5	41826538	missense	probably damaging	0.96
R6284:Bod1l	UTSW	5	41818787	missense	probably benign	0.35
R6483:Bod1l	UTSW	5	41821082	missense	probably benign	0.03
R6485:Bod1l	UTSW	5	41817116	missense	possibly damaging	0.93
R6575:Bod1l	UTSW	5	41838068	missense	probably damaging	1.00
R6679:Bod1l	UTSW	5	41816666	missense	probably damaging	0.97
R6788:Bod1l	UTSW	5	41821873	nonsense	probably null
R7006:Bod1l	UTSW	5	41832552	missense	probably damaging	1.00
R7095:Bod1l	UTSW	5	41795068	critical splice donor site	probably null
R7111:Bod1l	UTSW	5	41813120	critical splice donor site	probably null
R7190:Bod1l	UTSW	5	41819938	missense	probably benign	0.14
R7311:Bod1l	UTSW	5	41794333	missense	possibly damaging	0.57
R7336:Bod1l	UTSW	5	41821524	missense	probably damaging	1.00
R7341:Bod1l	UTSW	5	41788857	missense	probably benign	0.00
R7396:Bod1l	UTSW	5	41831546	missense	probably damaging	1.00
R7431:Bod1l	UTSW	5	41813120	critical splice donor site	probably null
R7442:Bod1l	UTSW	5	41807179	missense	probably damaging	0.96
R7539:Bod1l	UTSW	5	41817860	missense	possibly damaging	0.65
R7583:Bod1l	UTSW	5	41833790	missense	probably damaging	1.00
R7679:Bod1l	UTSW	5	41820643	frame shift	probably null
R7748:Bod1l	UTSW	5	41832340	missense	probably damaging	0.97
R7767:Bod1l	UTSW	5	41816756	missense	probably benign	0.01
R7773:Bod1l	UTSW	5	41832712	missense	probably benign	0.14
R7782:Bod1l	UTSW	5	41817943	missense	probably benign	0.01
R7860:Bod1l	UTSW	5	41819265	missense	probably damaging	1.00
R7975:Bod1l	UTSW	5	41816277	missense	possibly damaging	0.90
R7977:Bod1l	UTSW	5	41795070	missense	probably damaging	1.00
R7987:Bod1l	UTSW	5	41795070	missense	probably damaging	1.00
R8104:Bod1l	UTSW	5	41833732	nonsense	probably null
R8217:Bod1l	UTSW	5	41831507	missense	probably damaging	1.00
R8307:Bod1l	UTSW	5	41821155	missense	probably damaging	1.00
R8469:Bod1l	UTSW	5	41821491	missense	possibly damaging	0.86
R8506:Bod1l	UTSW	5	41819055	nonsense	probably null
R8934:Bod1l	UTSW	5	41819601	missense	probably benign	0.11
R8984:Bod1l	UTSW	5	41788872	missense	probably damaging	1.00
R8989:Bod1l	UTSW	5	41821682	missense	probably benign	0.00
R9128:Bod1l	UTSW	5	41788923	missense	probably benign	0.22
R9129:Bod1l	UTSW	5	41818877	missense	probably damaging	0.99
R9198:Bod1l	UTSW	5	41799786	missense	probably benign	0.08
R9254:Bod1l	UTSW	5	41821880	missense	probably damaging	1.00
X0027:Bod1l	UTSW	5	41832669	missense	probably benign	0.20
X0058:Bod1l	UTSW	5	41824018	missense	probably damaging	1.00
Z1088:Bod1l	UTSW	5	41808764	missense	possibly damaging	0.95
Z1088:Bod1l	UTSW	5	41821146	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGTTGGCATTCCTCTCTGAG -3'
(R):5'- ACGTGCACTAGCCTAAGCAG -3'

Sequencing Primer
(F):5'- GGCTGTGCTACTGTCCCCTG -3'
(R):5'- CCTAAGCAGGCATGAAGAGAATC -3'

Posted On

2021-10-11