Incidental Mutation 'R8993:Qdpr'
ID 684533
Institutional Source Beutler Lab
Gene Symbol Qdpr
Ensembl Gene ENSMUSG00000015806
Gene Name quinoid dihydropteridine reductase
Synonyms 2610008L04Rik
MMRRC Submission 068824-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.221) question?
Stock # R8993 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 45591374-45607571 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 45607386 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 20 (G20D)
Ref Sequence ENSEMBL: ENSMUSP00000015950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015950] [ENSMUST00000053250] [ENSMUST00000117425] [ENSMUST00000118097] [ENSMUST00000120867] [ENSMUST00000127562] [ENSMUST00000154962] [ENSMUST00000197946] [ENSMUST00000198258]
AlphaFold Q8BVI4
Predicted Effect probably damaging
Transcript: ENSMUST00000015950
AA Change: G20D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015950
Gene: ENSMUSG00000015806
AA Change: G20D

DomainStartEndE-ValueType
Pfam:adh_short 8 195 5.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053250
SMART Domains Protein: ENSMUSP00000058204
Gene: ENSMUSG00000049530

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
transmembrane domain 102 124 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
low complexity region 176 187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117425
SMART Domains Protein: ENSMUSP00000112469
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 189 1e-124 PDB
SCOP:d1hdr__ 7 189 4e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118097
SMART Domains Protein: ENSMUSP00000113958
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 189 1e-124 PDB
SCOP:d1hdr__ 7 189 4e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120867
SMART Domains Protein: ENSMUSP00000113203
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 189 1e-124 PDB
SCOP:d1hdr__ 7 189 4e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127562
AA Change: G20D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115453
Gene: ENSMUSG00000015806
AA Change: G20D

DomainStartEndE-ValueType
PDB:1DIR|D 1 137 7e-67 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000154962
AA Change: G20D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122081
Gene: ENSMUSG00000015806
AA Change: G20D

DomainStartEndE-ValueType
PDB:1DIR|D 1 159 7e-72 PDB
SCOP:d1hdr__ 6 159 6e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000197946
AA Change: G20D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143584
Gene: ENSMUSG00000015806
AA Change: G20D

DomainStartEndE-ValueType
PDB:1DIR|D 1 213 1e-125 PDB
SCOP:d1hdr__ 6 162 2e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198258
SMART Domains Protein: ENSMUSP00000143741
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 139 8e-86 PDB
SCOP:d1hdr__ 14 139 6e-21 SMART
Meta Mutation Damage Score 0.9526 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme dihydropteridine reductase, which catalyzes the NADH-mediated reduction of quinonoid dihydrobiopterin. This enzyme is an essential component of the pterin-dependent aromatic amino acid hydroxylating systems. Mutations in this gene resulting in QDPR deficiency include aberrant splicing, amino acid substitutions, insertions, or premature terminations. Dihydropteridine reductase deficiency presents as atypical phenylketonuria due to insufficient production of biopterin, a cofactor for phenylalanine hydroxylase. [provided by RefSeq, Jul 2008]
PHENOTYPE: A portion of mice homozygous for a knock-out allele display abnormal rib-sternum attachment, a split xiphoid process, and lumbar vertebral transformation. Another knock-out allele exhibits abnormal folate and biopterin metabolism and oxidative stress in the liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A T 5: 113,841,842 (GRCm39) C92* probably null Het
A830018L16Rik G T 1: 11,615,491 (GRCm39) E155* probably null Het
Acaa1a A T 9: 119,178,418 (GRCm39) probably null Het
Adcy4 T C 14: 56,008,835 (GRCm39) E864G probably null Het
Adcy4 T C 14: 56,016,156 (GRCm39) D387G probably damaging Het
Ank1 C T 8: 23,588,955 (GRCm39) H574Y probably damaging Het
Arhgef16 C T 4: 154,371,495 (GRCm39) E233K probably damaging Het
Arhgef26 A T 3: 62,355,525 (GRCm39) Y699F probably benign Het
BB014433 C T 8: 15,092,101 (GRCm39) V251M probably damaging Het
Bcan G A 3: 87,901,529 (GRCm39) A391V probably benign Het
Bod1l A C 5: 41,974,210 (GRCm39) V2368G probably benign Het
Braf A G 6: 39,639,085 (GRCm39) V222A probably damaging Het
Cd33 G T 7: 43,182,871 (GRCm39) probably benign Het
Cdkl2 T A 5: 92,170,010 (GRCm39) K324N probably damaging Het
Celf6 A T 9: 59,510,154 (GRCm39) T199S probably damaging Het
Cmtm4 A C 8: 105,081,798 (GRCm39) D196E probably benign Het
Cntn1 G A 15: 92,132,347 (GRCm39) V148M probably damaging Het
Col1a2 C A 6: 4,535,451 (GRCm39) P921H unknown Het
Crmp1 T C 5: 37,399,490 (GRCm39) M1T probably null Het
Dnah7a A T 1: 53,543,262 (GRCm39) Y2303N probably damaging Het
Dock10 G T 1: 80,551,888 (GRCm39) T650K probably benign Het
Eif1ad15 A G 12: 88,288,170 (GRCm39) F28L probably benign Het
Fam24a A G 7: 130,938,269 (GRCm39) D53G probably benign Het
Foxa2 A T 2: 147,886,626 (GRCm39) M69K probably benign Het
Gatad2a T A 8: 70,362,585 (GRCm39) H601L probably damaging Het
Gimap4 A C 6: 48,667,539 (GRCm39) D98A probably damaging Het
Gm14295 G T 2: 176,501,623 (GRCm39) R371L possibly damaging Het
Golim4 G T 3: 75,785,435 (GRCm39) A652E probably benign Het
Grid1 A G 14: 34,748,899 (GRCm39) I240V probably benign Het
Iqsec3 T A 6: 121,390,272 (GRCm39) T400S unknown Het
Itk G A 11: 46,225,735 (GRCm39) R539C probably damaging Het
Kif27 T A 13: 58,473,912 (GRCm39) D695V possibly damaging Het
Krt79 T C 15: 101,839,441 (GRCm39) probably benign Het
Lama2 C A 10: 27,298,710 (GRCm39) V129L possibly damaging Het
Lonrf1 C A 8: 36,696,392 (GRCm39) E552D possibly damaging Het
Mpp3 A G 11: 101,891,491 (GRCm39) I549T probably benign Het
Nat1 T C 8: 67,944,394 (GRCm39) Y260H probably benign Het
Nipal2 T A 15: 34,648,983 (GRCm39) K69* probably null Het
Nlrx1 G T 9: 44,168,238 (GRCm39) probably benign Het
Pde1b C A 15: 103,429,852 (GRCm39) A115E probably benign Het
Pde4dip A G 3: 97,673,810 (GRCm39) Y369H probably damaging Het
Pnpla7 A G 2: 24,943,431 (GRCm39) Y1286C possibly damaging Het
Poglut2 G T 1: 44,151,924 (GRCm39) L322I possibly damaging Het
Pramel5 T C 4: 143,999,529 (GRCm39) E186G possibly damaging Het
Rmnd1 T G 10: 4,357,918 (GRCm39) I364L probably benign Het
Slc5a4a A T 10: 76,022,369 (GRCm39) E568V probably benign Het
Slc6a18 T A 13: 73,816,390 (GRCm39) I330F probably benign Het
Spesp1 T C 9: 62,180,552 (GRCm39) T119A possibly damaging Het
Sypl1 G A 12: 33,025,662 (GRCm39) S242N probably benign Het
Tbx18 G A 9: 87,612,770 (GRCm39) T43M probably benign Het
Tm7sf2 T A 19: 6,113,956 (GRCm39) D263V probably damaging Het
Trbv21 T C 6: 41,179,924 (GRCm39) I80T probably damaging Het
Ttc3 T A 16: 94,228,667 (GRCm39) L747Q possibly damaging Het
Ttll11 T C 2: 35,707,813 (GRCm39) D498G possibly damaging Het
Ttn T C 2: 76,583,714 (GRCm39) Y22431C probably null Het
Ubtfl1 T A 9: 18,321,637 (GRCm39) S388R Het
Vmn2r118 A T 17: 55,917,835 (GRCm39) L226I possibly damaging Het
Wdr46 A G 17: 34,168,156 (GRCm39) H576R probably benign Het
Zfp426 A G 9: 20,386,296 (GRCm39) F62L probably damaging Het
Other mutations in Qdpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02114:Qdpr APN 5 45,592,018 (GRCm39) missense possibly damaging 0.93
R0907:Qdpr UTSW 5 45,596,728 (GRCm39) missense probably benign 0.16
R1387:Qdpr UTSW 5 45,607,480 (GRCm39) start gained probably benign
R1964:Qdpr UTSW 5 45,596,660 (GRCm39) missense possibly damaging 0.58
R2431:Qdpr UTSW 5 45,602,072 (GRCm39) missense probably damaging 1.00
R4586:Qdpr UTSW 5 45,596,669 (GRCm39) missense possibly damaging 0.60
R5678:Qdpr UTSW 5 45,604,979 (GRCm39) missense possibly damaging 0.65
R5754:Qdpr UTSW 5 45,596,727 (GRCm39) missense probably damaging 0.98
R7392:Qdpr UTSW 5 45,596,718 (GRCm39) missense probably benign 0.37
R7939:Qdpr UTSW 5 45,607,407 (GRCm39) missense probably damaging 1.00
R8482:Qdpr UTSW 5 45,596,688 (GRCm39) missense probably benign 0.05
R8891:Qdpr UTSW 5 45,604,982 (GRCm39) missense probably damaging 0.99
R9445:Qdpr UTSW 5 45,596,669 (GRCm39) missense probably benign
X0022:Qdpr UTSW 5 45,596,697 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCACTTAAACGGCGTTTAC -3'
(R):5'- TATTGGTCGAAGCAGGAGGC -3'

Sequencing Primer
(F):5'- TCACTAGGCTAGTAACTTAGGGC -3'
(R):5'- GTGGCTCCGCAATGTCTC -3'
Posted On 2021-10-11