Incidental Mutation 'R8993:Col1a2'
ID 684536
Institutional Source Beutler Lab
Gene Symbol Col1a2
Ensembl Gene ENSMUSG00000029661
Gene Name collagen, type I, alpha 2
Synonyms Cola2, Cola-2, Col1a-2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8993 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 4504814-4541544 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 4535451 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Histidine at position 921 (P921H)
Ref Sequence ENSEMBL: ENSMUSP00000031668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031668]
AlphaFold Q01149
Predicted Effect unknown
Transcript: ENSMUST00000031668
AA Change: P921H
SMART Domains Protein: ENSMUSP00000031668
Gene: ENSMUSG00000029661
AA Change: P921H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Collagen 30 91 1e-8 PFAM
Pfam:Collagen 88 155 8.2e-10 PFAM
internal_repeat_3 172 223 7.52e-12 PROSPERO
low complexity region 225 271 N/A INTRINSIC
low complexity region 274 313 N/A INTRINSIC
low complexity region 316 352 N/A INTRINSIC
internal_repeat_2 354 386 2.06e-15 PROSPERO
internal_repeat_1 355 469 5.71e-17 PROSPERO
internal_repeat_4 361 472 2.1e-11 PROSPERO
Pfam:Collagen 475 535 7.7e-11 PFAM
Pfam:Collagen 521 588 8.2e-10 PFAM
low complexity region 598 625 N/A INTRINSIC
low complexity region 628 655 N/A INTRINSIC
low complexity region 679 722 N/A INTRINSIC
low complexity region 724 757 N/A INTRINSIC
low complexity region 759 784 N/A INTRINSIC
low complexity region 792 820 N/A INTRINSIC
internal_repeat_5 823 850 5.93e-7 PROSPERO
low complexity region 853 883 N/A INTRINSIC
Pfam:Collagen 895 969 1e-8 PFAM
low complexity region 987 1007 N/A INTRINSIC
internal_repeat_5 1009 1042 5.93e-7 PROSPERO
Pfam:Collagen 1051 1120 5.8e-9 PFAM
COLFI 1138 1372 2.1e-150 SMART
Meta Mutation Damage Score 0.3362 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of the fibril-forming type I collagen, the most abundant protein of bone, skin and tendon extracellular matrices. The encoded protein, in association with alpha-1 subunit, forms heterotrimeric type I procollagen that undergoes proteolytic processing during fibril formation. Mice harboring certain mutations in the encoded gene exhibit symptoms of moderate to severe forms of osteogenesis imperfecta. [provided by RefSeq, Dec 2015]
PHENOTYPE: The tails of mice heterozygous for an ENU-induced mutation at this locus are flexible or rubbery. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A T 5: 113,703,781 C92* probably null Het
A830018L16Rik G T 1: 11,545,267 E155* probably null Het
Acaa1a A T 9: 119,349,352 probably null Het
Adcy4 T C 14: 55,771,378 E864G probably null Het
Adcy4 T C 14: 55,778,699 D387G probably damaging Het
Ank1 C T 8: 23,098,939 H574Y probably damaging Het
Arhgef16 C T 4: 154,287,038 E233K probably damaging Het
Arhgef26 A T 3: 62,448,104 Y699F probably benign Het
BB014433 C T 8: 15,042,101 V251M probably damaging Het
Bcan G A 3: 87,994,222 A391V probably benign Het
Bod1l A C 5: 41,816,867 V2368G probably benign Het
Braf A G 6: 39,662,151 V222A probably damaging Het
Cd33 G T 7: 43,533,447 probably benign Het
Cdkl2 T A 5: 92,022,151 K324N probably damaging Het
Celf6 A T 9: 59,602,871 T199S probably damaging Het
Cmtm4 A C 8: 104,355,166 D196E probably benign Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Crmp1 T C 5: 37,242,146 M1T probably null Het
Dnah7a A T 1: 53,504,103 Y2303N probably damaging Het
Dock10 G T 1: 80,574,171 T650K probably benign Het
Fam24a A G 7: 131,336,540 D53G probably benign Het
Foxa2 A T 2: 148,044,706 M69K probably benign Het
Gatad2a T A 8: 69,909,935 H601L probably damaging Het
Gimap4 A C 6: 48,690,605 D98A probably damaging Het
Gm14295 G T 2: 176,809,830 R371L possibly damaging Het
Gm5039 A G 12: 88,321,400 F28L probably benign Het
Golim4 G T 3: 75,878,128 A652E probably benign Het
Grid1 A G 14: 35,026,942 I240V probably benign Het
Iqsec3 T A 6: 121,413,313 T400S unknown Het
Itk G A 11: 46,334,908 R539C probably damaging Het
Kdelc1 G T 1: 44,112,764 L322I possibly damaging Het
Kif27 T A 13: 58,326,098 D695V possibly damaging Het
Krt79 T C 15: 101,931,006 probably benign Het
Lama2 C A 10: 27,422,714 V129L possibly damaging Het
Lonrf1 C A 8: 36,229,238 E552D possibly damaging Het
Mpp3 A G 11: 102,000,665 I549T probably benign Het
Nat1 T C 8: 67,491,742 Y260H probably benign Het
Nipal2 T A 15: 34,648,837 K69* probably null Het
Nlrx1 G T 9: 44,256,941 probably benign Het
Pde1b C A 15: 103,521,425 A115E probably benign Het
Pde4dip A G 3: 97,766,494 Y369H probably damaging Het
Pnpla7 A G 2: 25,053,419 Y1286C possibly damaging Het
Pramel5 T C 4: 144,272,959 E186G possibly damaging Het
Qdpr C T 5: 45,450,044 G20D probably damaging Het
Rmnd1 T G 10: 4,407,918 I364L probably benign Het
Slc5a4a A T 10: 76,186,535 E568V probably benign Het
Slc6a18 T A 13: 73,668,271 I330F probably benign Het
Spesp1 T C 9: 62,273,270 T119A possibly damaging Het
Sypl G A 12: 32,975,663 S242N probably benign Het
Tbx18 G A 9: 87,730,717 T43M probably benign Het
Tm7sf2 T A 19: 6,063,926 D263V probably damaging Het
Trbv21 T C 6: 41,202,990 I80T probably damaging Het
Ttc3 T A 16: 94,427,808 L747Q possibly damaging Het
Ttll11 T C 2: 35,817,801 D498G possibly damaging Het
Ttn T C 2: 76,753,370 Y22431C probably null Het
Ubtfl1 T A 9: 18,410,341 S388R Het
Vmn2r118 A T 17: 55,610,835 L226I possibly damaging Het
Wdr46 A G 17: 33,949,182 H576R probably benign Het
Zfp426 A G 9: 20,475,000 F62L probably damaging Het
Other mutations in Col1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Col1a2 APN 6 4531095 splice site probably benign
IGL01126:Col1a2 APN 6 4535846 missense unknown
IGL01129:Col1a2 APN 6 4535846 missense unknown
IGL01286:Col1a2 APN 6 4533891 missense unknown
IGL01687:Col1a2 APN 6 4520258 nonsense probably null
IGL01866:Col1a2 APN 6 4524132 missense probably damaging 1.00
IGL02010:Col1a2 APN 6 4512416 critical splice donor site probably null
IGL02100:Col1a2 APN 6 4524177 splice site probably benign
IGL02140:Col1a2 APN 6 4515639 missense unknown
IGL02474:Col1a2 APN 6 4516398 missense unknown
IGL02510:Col1a2 APN 6 4516398 missense unknown
IGL02525:Col1a2 APN 6 4531355 splice site probably benign
IGL02839:Col1a2 APN 6 4538748 missense unknown
IGL03134:Col1a2 APN 6 4521387 unclassified probably benign
IGL03385:Col1a2 APN 6 4539612 missense unknown
P4717OSA:Col1a2 UTSW 6 4518822 unclassified probably benign
PIT4453001:Col1a2 UTSW 6 4527079 missense possibly damaging 0.94
R0021:Col1a2 UTSW 6 4518822 unclassified probably benign
R0022:Col1a2 UTSW 6 4518822 unclassified probably benign
R0025:Col1a2 UTSW 6 4518822 unclassified probably benign
R0027:Col1a2 UTSW 6 4518822 unclassified probably benign
R0028:Col1a2 UTSW 6 4518822 unclassified probably benign
R0031:Col1a2 UTSW 6 4518822 unclassified probably benign
R0038:Col1a2 UTSW 6 4518822 unclassified probably benign
R0064:Col1a2 UTSW 6 4518822 unclassified probably benign
R0102:Col1a2 UTSW 6 4520775 missense possibly damaging 0.92
R0147:Col1a2 UTSW 6 4518822 unclassified probably benign
R0323:Col1a2 UTSW 6 4518822 unclassified probably benign
R0326:Col1a2 UTSW 6 4518822 unclassified probably benign
R0326:Col1a2 UTSW 6 4537838 missense unknown
R0335:Col1a2 UTSW 6 4531956 splice site probably benign
R0359:Col1a2 UTSW 6 4518822 unclassified probably benign
R0363:Col1a2 UTSW 6 4518822 unclassified probably benign
R0612:Col1a2 UTSW 6 4516003 missense unknown
R0729:Col1a2 UTSW 6 4518822 unclassified probably benign
R0746:Col1a2 UTSW 6 4518822 unclassified probably benign
R0760:Col1a2 UTSW 6 4518822 unclassified probably benign
R0761:Col1a2 UTSW 6 4518822 unclassified probably benign
R0801:Col1a2 UTSW 6 4531316 missense unknown
R0845:Col1a2 UTSW 6 4518822 unclassified probably benign
R0846:Col1a2 UTSW 6 4518822 unclassified probably benign
R0969:Col1a2 UTSW 6 4518822 unclassified probably benign
R0970:Col1a2 UTSW 6 4518822 unclassified probably benign
R1105:Col1a2 UTSW 6 4518822 unclassified probably benign
R1106:Col1a2 UTSW 6 4518822 unclassified probably benign
R1107:Col1a2 UTSW 6 4518822 unclassified probably benign
R1134:Col1a2 UTSW 6 4518822 unclassified probably benign
R1135:Col1a2 UTSW 6 4518822 unclassified probably benign
R1152:Col1a2 UTSW 6 4518822 unclassified probably benign
R1333:Col1a2 UTSW 6 4515684 critical splice donor site probably null
R1341:Col1a2 UTSW 6 4518822 unclassified probably benign
R1470:Col1a2 UTSW 6 4518822 unclassified probably benign
R1470:Col1a2 UTSW 6 4518822 unclassified probably benign
R1477:Col1a2 UTSW 6 4539673 missense unknown
R1566:Col1a2 UTSW 6 4523613 missense probably damaging 1.00
R1691:Col1a2 UTSW 6 4536038 missense unknown
R1713:Col1a2 UTSW 6 4538691 missense unknown
R1754:Col1a2 UTSW 6 4518822 unclassified probably benign
R1755:Col1a2 UTSW 6 4518822 unclassified probably benign
R2050:Col1a2 UTSW 6 4518822 unclassified probably benign
R2178:Col1a2 UTSW 6 4531143 missense unknown
R2194:Col1a2 UTSW 6 4518822 unclassified probably benign
R2195:Col1a2 UTSW 6 4518822 unclassified probably benign
R2235:Col1a2 UTSW 6 4518822 unclassified probably benign
R2261:Col1a2 UTSW 6 4518822 unclassified probably benign
R2262:Col1a2 UTSW 6 4518822 unclassified probably benign
R2263:Col1a2 UTSW 6 4518822 unclassified probably benign
R2289:Col1a2 UTSW 6 4518822 unclassified probably benign
R2310:Col1a2 UTSW 6 4518822 unclassified probably benign
R2312:Col1a2 UTSW 6 4518822 unclassified probably benign
R2330:Col1a2 UTSW 6 4528300 splice site probably benign
R2333:Col1a2 UTSW 6 4532747 missense unknown
R2401:Col1a2 UTSW 6 4518822 unclassified probably benign
R2403:Col1a2 UTSW 6 4518822 unclassified probably benign
R2448:Col1a2 UTSW 6 4518822 unclassified probably benign
R2513:Col1a2 UTSW 6 4531223 splice site probably null
R2862:Col1a2 UTSW 6 4518822 unclassified probably benign
R2884:Col1a2 UTSW 6 4518822 unclassified probably benign
R2885:Col1a2 UTSW 6 4518822 unclassified probably benign
R2913:Col1a2 UTSW 6 4519923 unclassified probably benign
R2937:Col1a2 UTSW 6 4519882 unclassified probably benign
R2937:Col1a2 UTSW 6 4520788 missense possibly damaging 0.92
R2938:Col1a2 UTSW 6 4520788 missense possibly damaging 0.92
R3608:Col1a2 UTSW 6 4518822 unclassified probably benign
R3692:Col1a2 UTSW 6 4510710 missense possibly damaging 0.84
R3805:Col1a2 UTSW 6 4518822 unclassified probably benign
R3806:Col1a2 UTSW 6 4518822 unclassified probably benign
R3826:Col1a2 UTSW 6 4516960 unclassified probably benign
R3903:Col1a2 UTSW 6 4518822 unclassified probably benign
R3904:Col1a2 UTSW 6 4518822 unclassified probably benign
R3922:Col1a2 UTSW 6 4518822 unclassified probably benign
R3926:Col1a2 UTSW 6 4518822 unclassified probably benign
R4106:Col1a2 UTSW 6 4518822 unclassified probably benign
R4107:Col1a2 UTSW 6 4518822 unclassified probably benign
R4108:Col1a2 UTSW 6 4518822 unclassified probably benign
R4109:Col1a2 UTSW 6 4510705 nonsense probably null
R4509:Col1a2 UTSW 6 4518822 unclassified probably benign
R4667:Col1a2 UTSW 6 4512412 missense unknown
R4909:Col1a2 UTSW 6 4529058 splice site probably benign
R5418:Col1a2 UTSW 6 4516931 unclassified probably benign
R5587:Col1a2 UTSW 6 4540531 missense unknown
R5598:Col1a2 UTSW 6 4516916 unclassified probably benign
R5673:Col1a2 UTSW 6 4539622 missense unknown
R5678:Col1a2 UTSW 6 4536239 missense unknown
R5763:Col1a2 UTSW 6 4515682 missense unknown
R5786:Col1a2 UTSW 6 4530223 missense unknown
R5872:Col1a2 UTSW 6 4531926 missense unknown
R6084:Col1a2 UTSW 6 4505840 start codon destroyed probably benign 0.01
R6134:Col1a2 UTSW 6 4538035 missense unknown
R6221:Col1a2 UTSW 6 4539490 missense unknown
R6481:Col1a2 UTSW 6 4538680 missense unknown
R6500:Col1a2 UTSW 6 4515517 missense unknown
R6890:Col1a2 UTSW 6 4539587 missense unknown
R7022:Col1a2 UTSW 6 4534639 missense unknown
R7033:Col1a2 UTSW 6 4516904 unclassified probably benign
R7195:Col1a2 UTSW 6 4510753 missense unknown
R7657:Col1a2 UTSW 6 4527152 missense probably null 0.99
R7686:Col1a2 UTSW 6 4518964 missense unknown
R7875:Col1a2 UTSW 6 4518500 missense unknown
R8023:Col1a2 UTSW 6 4533847 missense unknown
R8208:Col1a2 UTSW 6 4515260 splice site probably null
R8277:Col1a2 UTSW 6 4516410 missense probably null
R8438:Col1a2 UTSW 6 4515517 missense unknown
R8438:Col1a2 UTSW 6 4515518 missense unknown
R9109:Col1a2 UTSW 6 4515260 splice site probably null
R9298:Col1a2 UTSW 6 4515260 splice site probably null
R9315:Col1a2 UTSW 6 4540544 missense unknown
V5622:Col1a2 UTSW 6 4518822 unclassified probably benign
V5622:Col1a2 UTSW 6 4518822 unclassified probably benign
X0017:Col1a2 UTSW 6 4515675 missense unknown
Z1176:Col1a2 UTSW 6 4532750 missense unknown
Predicted Primers PCR Primer
(F):5'- CCATCTTGCAGGGGTGATTC -3'
(R):5'- CCTGCCAGCTTTACTGCAAAG -3'

Sequencing Primer
(F):5'- CCATCTTGCAGGGGTGATTCTTAATC -3'
(R):5'- TGCAAAGCAGGCTCATTATATGG -3'
Posted On 2021-10-11