Mutagenetix > Incidental Mutations

Incidental Mutation 'R8993:Col1a2'

684536

Institutional Source

Beutler Lab

Gene Symbol

Col1a2

Ensembl Gene

ENSMUSG00000029661

Gene Name

collagen, type I, alpha 2

Synonyms

Cola2, Cola-2, Col1a-2

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8993 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4504814-4541544 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 4535451 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Histidine at position 921 (P921H)

Ref Sequence

ENSEMBL: ENSMUSP00000031668 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031668]

AlphaFold

Q01149

Predicted Effect

unknown
Transcript: ENSMUST00000031668
AA Change: P921H

SMART Domains

Protein: ENSMUSP00000031668
Gene: ENSMUSG00000029661
AA Change: P921H

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Collagen	30	91	1e-8	PFAM
Pfam:Collagen	88	155	8.2e-10	PFAM
internal_repeat_3	172	223	7.52e-12	PROSPERO
low complexity region	225	271	N/A	INTRINSIC
low complexity region	274	313	N/A	INTRINSIC
low complexity region	316	352	N/A	INTRINSIC
internal_repeat_2	354	386	2.06e-15	PROSPERO
internal_repeat_1	355	469	5.71e-17	PROSPERO
internal_repeat_4	361	472	2.1e-11	PROSPERO
Pfam:Collagen	475	535	7.7e-11	PFAM
Pfam:Collagen	521	588	8.2e-10	PFAM
low complexity region	598	625	N/A	INTRINSIC
low complexity region	628	655	N/A	INTRINSIC
low complexity region	679	722	N/A	INTRINSIC
low complexity region	724	757	N/A	INTRINSIC
low complexity region	759	784	N/A	INTRINSIC
low complexity region	792	820	N/A	INTRINSIC
internal_repeat_5	823	850	5.93e-7	PROSPERO
low complexity region	853	883	N/A	INTRINSIC
Pfam:Collagen	895	969	1e-8	PFAM
low complexity region	987	1007	N/A	INTRINSIC
internal_repeat_5	1009	1042	5.93e-7	PROSPERO
Pfam:Collagen	1051	1120	5.8e-9	PFAM
COLFI	1138	1372	2.1e-150	SMART

Meta Mutation Damage Score

0.3362

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: This gene encodes the alpha-2 subunit of the fibril-forming type I collagen, the most abundant protein of bone, skin and tendon extracellular matrices. The encoded protein, in association with alpha-1 subunit, forms heterotrimeric type I procollagen that undergoes proteolytic processing during fibril formation. Mice harboring certain mutations in the encoded gene exhibit symptoms of moderate to severe forms of osteogenesis imperfecta. [provided by RefSeq, Dec 2015]
PHENOTYPE: The tails of mice heterozygous for an ENU-induced mutation at this locus are flexible or rubbery. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700069L16Rik	A	T	5: 113,703,781	C92*	probably null	Het
A830018L16Rik	G	T	1: 11,545,267	E155*	probably null	Het
Acaa1a	A	T	9: 119,349,352		probably null	Het
Adcy4	T	C	14: 55,771,378	E864G	probably null	Het
Adcy4	T	C	14: 55,778,699	D387G	probably damaging	Het
Ank1	C	T	8: 23,098,939	H574Y	probably damaging	Het
Arhgef16	C	T	4: 154,287,038	E233K	probably damaging	Het
Arhgef26	A	T	3: 62,448,104	Y699F	probably benign	Het
BB014433	C	T	8: 15,042,101	V251M	probably damaging	Het
Bcan	G	A	3: 87,994,222	A391V	probably benign	Het
Bod1l	A	C	5: 41,816,867	V2368G	probably benign	Het
Braf	A	G	6: 39,662,151	V222A	probably damaging	Het
Cd33	G	T	7: 43,533,447		probably benign	Het
Cdkl2	T	A	5: 92,022,151	K324N	probably damaging	Het
Celf6	A	T	9: 59,602,871	T199S	probably damaging	Het
Cmtm4	A	C	8: 104,355,166	D196E	probably benign	Het
Cntn1	G	A	15: 92,234,466	V148M	probably damaging	Het
Crmp1	T	C	5: 37,242,146	M1T	probably null	Het
Dnah7a	A	T	1: 53,504,103	Y2303N	probably damaging	Het
Dock10	G	T	1: 80,574,171	T650K	probably benign	Het
Fam24a	A	G	7: 131,336,540	D53G	probably benign	Het
Foxa2	A	T	2: 148,044,706	M69K	probably benign	Het
Gatad2a	T	A	8: 69,909,935	H601L	probably damaging	Het
Gimap4	A	C	6: 48,690,605	D98A	probably damaging	Het
Gm14295	G	T	2: 176,809,830	R371L	possibly damaging	Het
Gm5039	A	G	12: 88,321,400	F28L	probably benign	Het
Golim4	G	T	3: 75,878,128	A652E	probably benign	Het
Grid1	A	G	14: 35,026,942	I240V	probably benign	Het
Iqsec3	T	A	6: 121,413,313	T400S	unknown	Het
Itk	G	A	11: 46,334,908	R539C	probably damaging	Het
Kdelc1	G	T	1: 44,112,764	L322I	possibly damaging	Het
Kif27	T	A	13: 58,326,098	D695V	possibly damaging	Het
Krt79	T	C	15: 101,931,006		probably benign	Het
Lama2	C	A	10: 27,422,714	V129L	possibly damaging	Het
Lonrf1	C	A	8: 36,229,238	E552D	possibly damaging	Het
Mpp3	A	G	11: 102,000,665	I549T	probably benign	Het
Nat1	T	C	8: 67,491,742	Y260H	probably benign	Het
Nipal2	T	A	15: 34,648,837	K69*	probably null	Het
Nlrx1	G	T	9: 44,256,941		probably benign	Het
Pde1b	C	A	15: 103,521,425	A115E	probably benign	Het
Pde4dip	A	G	3: 97,766,494	Y369H	probably damaging	Het
Pnpla7	A	G	2: 25,053,419	Y1286C	possibly damaging	Het
Pramel5	T	C	4: 144,272,959	E186G	possibly damaging	Het
Qdpr	C	T	5: 45,450,044	G20D	probably damaging	Het
Rmnd1	T	G	10: 4,407,918	I364L	probably benign	Het
Slc5a4a	A	T	10: 76,186,535	E568V	probably benign	Het
Slc6a18	T	A	13: 73,668,271	I330F	probably benign	Het
Spesp1	T	C	9: 62,273,270	T119A	possibly damaging	Het
Sypl	G	A	12: 32,975,663	S242N	probably benign	Het
Tbx18	G	A	9: 87,730,717	T43M	probably benign	Het
Tm7sf2	T	A	19: 6,063,926	D263V	probably damaging	Het
Trbv21	T	C	6: 41,202,990	I80T	probably damaging	Het
Ttc3	T	A	16: 94,427,808	L747Q	possibly damaging	Het
Ttll11	T	C	2: 35,817,801	D498G	possibly damaging	Het
Ttn	T	C	2: 76,753,370	Y22431C	probably null	Het
Ubtfl1	T	A	9: 18,410,341	S388R		Het
Vmn2r118	A	T	17: 55,610,835	L226I	possibly damaging	Het
Wdr46	A	G	17: 33,949,182	H576R	probably benign	Het
Zfp426	A	G	9: 20,475,000	F62L	probably damaging	Het

Other mutations in Col1a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00839:Col1a2	APN	6	4531095	splice site	probably benign
IGL01126:Col1a2	APN	6	4535846	missense	unknown
IGL01129:Col1a2	APN	6	4535846	missense	unknown
IGL01286:Col1a2	APN	6	4533891	missense	unknown
IGL01687:Col1a2	APN	6	4520258	nonsense	probably null
IGL01866:Col1a2	APN	6	4524132	missense	probably damaging	1.00
IGL02010:Col1a2	APN	6	4512416	critical splice donor site	probably null
IGL02100:Col1a2	APN	6	4524177	splice site	probably benign
IGL02140:Col1a2	APN	6	4515639	missense	unknown
IGL02474:Col1a2	APN	6	4516398	missense	unknown
IGL02510:Col1a2	APN	6	4516398	missense	unknown
IGL02525:Col1a2	APN	6	4531355	splice site	probably benign
IGL02839:Col1a2	APN	6	4538748	missense	unknown
IGL03134:Col1a2	APN	6	4521387	unclassified	probably benign
IGL03385:Col1a2	APN	6	4539612	missense	unknown
P4717OSA:Col1a2	UTSW	6	4518822	unclassified	probably benign
PIT4453001:Col1a2	UTSW	6	4527079	missense	possibly damaging	0.94
R0021:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0022:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0025:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0027:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0028:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0031:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0038:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0064:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0102:Col1a2	UTSW	6	4520775	missense	possibly damaging	0.92
R0147:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0323:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0326:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0326:Col1a2	UTSW	6	4537838	missense	unknown
R0335:Col1a2	UTSW	6	4531956	splice site	probably benign
R0359:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0363:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0612:Col1a2	UTSW	6	4516003	missense	unknown
R0729:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0746:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0760:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0761:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0801:Col1a2	UTSW	6	4531316	missense	unknown
R0845:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0846:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0969:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0970:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1105:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1106:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1107:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1134:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1135:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1152:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1333:Col1a2	UTSW	6	4515684	critical splice donor site	probably null
R1341:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1470:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1470:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1477:Col1a2	UTSW	6	4539673	missense	unknown
R1566:Col1a2	UTSW	6	4523613	missense	probably damaging	1.00
R1691:Col1a2	UTSW	6	4536038	missense	unknown
R1713:Col1a2	UTSW	6	4538691	missense	unknown
R1754:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1755:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2050:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2178:Col1a2	UTSW	6	4531143	missense	unknown
R2194:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2195:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2235:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2261:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2262:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2263:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2289:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2310:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2312:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2330:Col1a2	UTSW	6	4528300	splice site	probably benign
R2333:Col1a2	UTSW	6	4532747	missense	unknown
R2401:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2403:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2448:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2513:Col1a2	UTSW	6	4531223	splice site	probably null
R2862:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2884:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2885:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2913:Col1a2	UTSW	6	4519923	unclassified	probably benign
R2937:Col1a2	UTSW	6	4519882	unclassified	probably benign
R2937:Col1a2	UTSW	6	4520788	missense	possibly damaging	0.92
R2938:Col1a2	UTSW	6	4520788	missense	possibly damaging	0.92
R3608:Col1a2	UTSW	6	4518822	unclassified	probably benign
R3692:Col1a2	UTSW	6	4510710	missense	possibly damaging	0.84
R3805:Col1a2	UTSW	6	4518822	unclassified	probably benign
R3806:Col1a2	UTSW	6	4518822	unclassified	probably benign
R3826:Col1a2	UTSW	6	4516960	unclassified	probably benign
R3903:Col1a2	UTSW	6	4518822	unclassified	probably benign
R3904:Col1a2	UTSW	6	4518822	unclassified	probably benign
R3922:Col1a2	UTSW	6	4518822	unclassified	probably benign
R3926:Col1a2	UTSW	6	4518822	unclassified	probably benign
R4106:Col1a2	UTSW	6	4518822	unclassified	probably benign
R4107:Col1a2	UTSW	6	4518822	unclassified	probably benign
R4108:Col1a2	UTSW	6	4518822	unclassified	probably benign
R4109:Col1a2	UTSW	6	4510705	nonsense	probably null
R4509:Col1a2	UTSW	6	4518822	unclassified	probably benign
R4667:Col1a2	UTSW	6	4512412	missense	unknown
R4909:Col1a2	UTSW	6	4529058	splice site	probably benign
R5418:Col1a2	UTSW	6	4516931	unclassified	probably benign
R5587:Col1a2	UTSW	6	4540531	missense	unknown
R5598:Col1a2	UTSW	6	4516916	unclassified	probably benign
R5673:Col1a2	UTSW	6	4539622	missense	unknown
R5678:Col1a2	UTSW	6	4536239	missense	unknown
R5763:Col1a2	UTSW	6	4515682	missense	unknown
R5786:Col1a2	UTSW	6	4530223	missense	unknown
R5872:Col1a2	UTSW	6	4531926	missense	unknown
R6084:Col1a2	UTSW	6	4505840	start codon destroyed	probably benign	0.01
R6134:Col1a2	UTSW	6	4538035	missense	unknown
R6221:Col1a2	UTSW	6	4539490	missense	unknown
R6481:Col1a2	UTSW	6	4538680	missense	unknown
R6500:Col1a2	UTSW	6	4515517	missense	unknown
R6890:Col1a2	UTSW	6	4539587	missense	unknown
R7022:Col1a2	UTSW	6	4534639	missense	unknown
R7033:Col1a2	UTSW	6	4516904	unclassified	probably benign
R7195:Col1a2	UTSW	6	4510753	missense	unknown
R7657:Col1a2	UTSW	6	4527152	missense	probably null	0.99
R7686:Col1a2	UTSW	6	4518964	missense	unknown
R7875:Col1a2	UTSW	6	4518500	missense	unknown
R8023:Col1a2	UTSW	6	4533847	missense	unknown
R8208:Col1a2	UTSW	6	4515260	splice site	probably null
R8277:Col1a2	UTSW	6	4516410	missense	probably null
R8438:Col1a2	UTSW	6	4515517	missense	unknown
R8438:Col1a2	UTSW	6	4515518	missense	unknown
R9109:Col1a2	UTSW	6	4515260	splice site	probably null
R9298:Col1a2	UTSW	6	4515260	splice site	probably null
R9315:Col1a2	UTSW	6	4540544	missense	unknown
V5622:Col1a2	UTSW	6	4518822	unclassified	probably benign
V5622:Col1a2	UTSW	6	4518822	unclassified	probably benign
X0017:Col1a2	UTSW	6	4515675	missense	unknown
Z1176:Col1a2	UTSW	6	4532750	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CCATCTTGCAGGGGTGATTC -3'
(R):5'- CCTGCCAGCTTTACTGCAAAG -3'

Sequencing Primer
(F):5'- CCATCTTGCAGGGGTGATTCTTAATC -3'
(R):5'- TGCAAAGCAGGCTCATTATATGG -3'

Posted On

2021-10-11