Incidental Mutation 'R8993:Braf'
ID 684537
Institutional Source Beutler Lab
Gene Symbol Braf
Ensembl Gene ENSMUSG00000002413
Gene Name Braf transforming gene
Synonyms Braf-2, D6Ertd631e, 9930012E13Rik, Braf2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8993 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 39603237-39725463 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 39662151 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 222 (V222A)
Ref Sequence ENSEMBL: ENSMUSP00000002487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002487] [ENSMUST00000101497]
AlphaFold P28028
Predicted Effect probably damaging
Transcript: ENSMUST00000002487
AA Change: V222A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002487
Gene: ENSMUSG00000002413
AA Change: V222A

DomainStartEndE-ValueType
low complexity region 5 30 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
coiled coil region 94 121 N/A INTRINSIC
RBD 139 211 1.04e-33 SMART
C1 219 264 1.05e-13 SMART
low complexity region 297 311 N/A INTRINSIC
low complexity region 316 326 N/A INTRINSIC
low complexity region 459 474 N/A INTRINSIC
Pfam:Pkinase_Tyr 494 751 9.6e-65 PFAM
Pfam:Pkinase 494 753 5.1e-60 PFAM
Pfam:Kinase-like 573 741 3e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101497
AA Change: V221A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099036
Gene: ENSMUSG00000002413
AA Change: V221A

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
coiled coil region 60 88 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
RBD 138 210 1.04e-33 SMART
C1 218 263 1.05e-13 SMART
low complexity region 296 310 N/A INTRINSIC
low complexity region 315 325 N/A INTRINSIC
low complexity region 406 421 N/A INTRINSIC
Pfam:Pkinase 441 698 8.2e-62 PFAM
Pfam:Pkinase_Tyr 441 698 1.5e-65 PFAM
Pfam:Kinase-like 523 688 3.2e-11 PFAM
Meta Mutation Damage Score 0.3075 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the raf/mil family of serine/threonine protein kinases. This protein plays a role in regulating the MAP kinase/ERKs signaling pathway, which affects cell division, differentiation, and secretion. Mutations in this gene are associated with cardiofaciocutaneous syndrome, a disease characterized by heart defects, mental retardation and a distinctive facial appearance. Mutations in this gene have also been associated with various cancers, including non-Hodgkin lymphoma, colorectal cancer, malignant melanoma, thyroid carcinoma, non-small cell lung carcinoma, and adenocarcinoma of lung. A pseudogene, which is located on chromosome X, has been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die during organogenesis, are smaller, have enlarged blood vessels, hemorrhaging, poor circulation, slow heartbeat and abnormal endothelial cell development. Mice homozygous for a targeted allele activated in neurons exhibit impaired neuronal differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A T 5: 113,703,781 C92* probably null Het
A830018L16Rik G T 1: 11,545,267 E155* probably null Het
Acaa1a A T 9: 119,349,352 probably null Het
Adcy4 T C 14: 55,771,378 E864G probably null Het
Adcy4 T C 14: 55,778,699 D387G probably damaging Het
Ank1 C T 8: 23,098,939 H574Y probably damaging Het
Arhgef16 C T 4: 154,287,038 E233K probably damaging Het
Arhgef26 A T 3: 62,448,104 Y699F probably benign Het
BB014433 C T 8: 15,042,101 V251M probably damaging Het
Bcan G A 3: 87,994,222 A391V probably benign Het
Bod1l A C 5: 41,816,867 V2368G probably benign Het
Cd33 G T 7: 43,533,447 probably benign Het
Cdkl2 T A 5: 92,022,151 K324N probably damaging Het
Celf6 A T 9: 59,602,871 T199S probably damaging Het
Cmtm4 A C 8: 104,355,166 D196E probably benign Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Col1a2 C A 6: 4,535,451 P921H unknown Het
Crmp1 T C 5: 37,242,146 M1T probably null Het
Dnah7a A T 1: 53,504,103 Y2303N probably damaging Het
Dock10 G T 1: 80,574,171 T650K probably benign Het
Fam24a A G 7: 131,336,540 D53G probably benign Het
Foxa2 A T 2: 148,044,706 M69K probably benign Het
Gatad2a T A 8: 69,909,935 H601L probably damaging Het
Gimap4 A C 6: 48,690,605 D98A probably damaging Het
Gm14295 G T 2: 176,809,830 R371L possibly damaging Het
Gm5039 A G 12: 88,321,400 F28L probably benign Het
Golim4 G T 3: 75,878,128 A652E probably benign Het
Grid1 A G 14: 35,026,942 I240V probably benign Het
Iqsec3 T A 6: 121,413,313 T400S unknown Het
Itk G A 11: 46,334,908 R539C probably damaging Het
Kdelc1 G T 1: 44,112,764 L322I possibly damaging Het
Kif27 T A 13: 58,326,098 D695V possibly damaging Het
Krt79 T C 15: 101,931,006 probably benign Het
Lama2 C A 10: 27,422,714 V129L possibly damaging Het
Lonrf1 C A 8: 36,229,238 E552D possibly damaging Het
Mpp3 A G 11: 102,000,665 I549T probably benign Het
Nat1 T C 8: 67,491,742 Y260H probably benign Het
Nipal2 T A 15: 34,648,837 K69* probably null Het
Nlrx1 G T 9: 44,256,941 probably benign Het
Pde1b C A 15: 103,521,425 A115E probably benign Het
Pde4dip A G 3: 97,766,494 Y369H probably damaging Het
Pnpla7 A G 2: 25,053,419 Y1286C possibly damaging Het
Pramel5 T C 4: 144,272,959 E186G possibly damaging Het
Qdpr C T 5: 45,450,044 G20D probably damaging Het
Rmnd1 T G 10: 4,407,918 I364L probably benign Het
Slc5a4a A T 10: 76,186,535 E568V probably benign Het
Slc6a18 T A 13: 73,668,271 I330F probably benign Het
Spesp1 T C 9: 62,273,270 T119A possibly damaging Het
Sypl G A 12: 32,975,663 S242N probably benign Het
Tbx18 G A 9: 87,730,717 T43M probably benign Het
Tm7sf2 T A 19: 6,063,926 D263V probably damaging Het
Trbv21 T C 6: 41,202,990 I80T probably damaging Het
Ttc3 T A 16: 94,427,808 L747Q possibly damaging Het
Ttll11 T C 2: 35,817,801 D498G possibly damaging Het
Ttn T C 2: 76,753,370 Y22431C probably null Het
Ubtfl1 T A 9: 18,410,341 S388R Het
Vmn2r118 A T 17: 55,610,835 L226I possibly damaging Het
Wdr46 A G 17: 33,949,182 H576R probably benign Het
Zfp426 A G 9: 20,475,000 F62L probably damaging Het
Other mutations in Braf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Braf APN 6 39660999 splice site probably null
IGL01616:Braf APN 6 39651652 missense probably damaging 1.00
IGL01621:Braf APN 6 39646853 intron probably benign
IGL01825:Braf APN 6 39639590 missense probably damaging 0.99
IGL02435:Braf APN 6 39646766 missense probably benign 0.00
IGL02629:Braf APN 6 39688299 missense possibly damaging 0.83
IGL02751:Braf APN 6 39660867 splice site probably benign
IGL02829:Braf APN 6 39627728 missense possibly damaging 0.62
R0041:Braf UTSW 6 39640479 missense probably damaging 1.00
R0041:Braf UTSW 6 39640479 missense probably damaging 1.00
R0497:Braf UTSW 6 39640549 splice site probably benign
R0512:Braf UTSW 6 39664989 splice site probably benign
R0604:Braf UTSW 6 39623697 missense probably damaging 1.00
R0726:Braf UTSW 6 39662148 missense possibly damaging 0.90
R1468:Braf UTSW 6 39665083 missense probably damaging 1.00
R1468:Braf UTSW 6 39665083 missense probably damaging 1.00
R1616:Braf UTSW 6 39643133 missense probably benign 0.35
R2160:Braf UTSW 6 39662073 missense probably damaging 1.00
R3722:Braf UTSW 6 39623676 missense probably damaging 1.00
R4407:Braf UTSW 6 39615720 missense probably damaging 1.00
R4540:Braf UTSW 6 39644333 missense probably damaging 1.00
R5026:Braf UTSW 6 39688287 missense probably benign 0.22
R5478:Braf UTSW 6 39677574 missense possibly damaging 0.94
R6284:Braf UTSW 6 39688282 missense possibly damaging 0.73
R6993:Braf UTSW 6 39643163 missense probably damaging 1.00
R7251:Braf UTSW 6 39677570 critical splice donor site probably null
R7385:Braf UTSW 6 39665108 critical splice acceptor site probably null
R7483:Braf UTSW 6 39627838 missense possibly damaging 0.86
R7511:Braf UTSW 6 39688253 missense probably damaging 0.99
R7660:Braf UTSW 6 39623641 missense possibly damaging 0.48
R8323:Braf UTSW 6 39643124 missense possibly damaging 0.83
R8527:Braf UTSW 6 39627759 missense probably benign 0.37
R8542:Braf UTSW 6 39627759 missense probably benign 0.37
Z1088:Braf UTSW 6 39662026 missense probably damaging 1.00
Z1176:Braf UTSW 6 39643182 missense probably damaging 1.00
Z1186:Braf UTSW 6 39725253 missense unknown
Z1186:Braf UTSW 6 39725255 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCCTCACGACTTTCAAAGTAC -3'
(R):5'- TGGGTAACATATCAGGGTCTCAATTC -3'

Sequencing Primer
(F):5'- TGTACTACAACGCTGGTG -3'
(R):5'- GGGATAGTATTTCAAGTCCCT -3'
Posted On 2021-10-11