Incidental Mutation 'R8993:Gimap4'
ID 684539
Institutional Source Beutler Lab
Gene Symbol Gimap4
Ensembl Gene ENSMUSG00000054435
Gene Name GTPase, IMAP family member 4
Synonyms Ian1, E430007K16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R8993 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 48684549-48692060 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 48690605 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 98 (D98A)
Ref Sequence ENSEMBL: ENSMUSP00000068398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067506] [ENSMUST00000090070] [ENSMUST00000118802] [ENSMUST00000119575] [ENSMUST00000121957] [ENSMUST00000156770]
AlphaFold Q99JY3
Predicted Effect probably damaging
Transcript: ENSMUST00000067506
AA Change: D98A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068398
Gene: ENSMUSG00000054435
AA Change: D98A

DomainStartEndE-ValueType
Pfam:AIG1 31 218 4.2e-72 PFAM
Pfam:MMR_HSR1 32 186 2.6e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000090070
AA Change: D98A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087524
Gene: ENSMUSG00000054435
AA Change: D98A

DomainStartEndE-ValueType
Pfam:AIG1 31 242 1.5e-80 PFAM
Pfam:MMR_HSR1 32 170 1.6e-10 PFAM
low complexity region 265 282 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118802
SMART Domains Protein: ENSMUSP00000112530
Gene: ENSMUSG00000054435

DomainStartEndE-ValueType
Pfam:AIG1 31 53 1.6e-7 PFAM
Pfam:AIG1 48 114 6.4e-17 PFAM
low complexity region 137 154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119575
SMART Domains Protein: ENSMUSP00000113989
Gene: ENSMUSG00000054435

DomainStartEndE-ValueType
SCOP:d1zin_1 31 50 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121957
SMART Domains Protein: ENSMUSP00000113016
Gene: ENSMUSG00000054435

DomainStartEndE-ValueType
Pfam:AIG1 31 55 4.3e-8 PFAM
Pfam:AIG1 48 89 1.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156770
SMART Domains Protein: ENSMUSP00000122070
Gene: ENSMUSG00000054435

DomainStartEndE-ValueType
Pfam:AIG1 31 69 6.7e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. This gene exists within a cluster of other related genes located on mouse chromosome 6. This family member encodes a lymphoid signaling protein that functions to accelerate programmed T-cell death, which appears to correlate with the phosphorylation status of the protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele show no detectable alterations in T-cell development, selection and activation; however, mutant T cells exhibit a delay in the execution of programmed cell death induced by intrinsic stimuli downstream of caspase-3 activation and phosphatidylserine exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A T 5: 113,703,781 C92* probably null Het
A830018L16Rik G T 1: 11,545,267 E155* probably null Het
Acaa1a A T 9: 119,349,352 probably null Het
Adcy4 T C 14: 55,771,378 E864G probably null Het
Adcy4 T C 14: 55,778,699 D387G probably damaging Het
Ank1 C T 8: 23,098,939 H574Y probably damaging Het
Arhgef16 C T 4: 154,287,038 E233K probably damaging Het
Arhgef26 A T 3: 62,448,104 Y699F probably benign Het
BB014433 C T 8: 15,042,101 V251M probably damaging Het
Bcan G A 3: 87,994,222 A391V probably benign Het
Bod1l A C 5: 41,816,867 V2368G probably benign Het
Braf A G 6: 39,662,151 V222A probably damaging Het
Cd33 G T 7: 43,533,447 probably benign Het
Cdkl2 T A 5: 92,022,151 K324N probably damaging Het
Celf6 A T 9: 59,602,871 T199S probably damaging Het
Cmtm4 A C 8: 104,355,166 D196E probably benign Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Col1a2 C A 6: 4,535,451 P921H unknown Het
Crmp1 T C 5: 37,242,146 M1T probably null Het
Dnah7a A T 1: 53,504,103 Y2303N probably damaging Het
Dock10 G T 1: 80,574,171 T650K probably benign Het
Fam24a A G 7: 131,336,540 D53G probably benign Het
Foxa2 A T 2: 148,044,706 M69K probably benign Het
Gatad2a T A 8: 69,909,935 H601L probably damaging Het
Gm14295 G T 2: 176,809,830 R371L possibly damaging Het
Gm5039 A G 12: 88,321,400 F28L probably benign Het
Golim4 G T 3: 75,878,128 A652E probably benign Het
Grid1 A G 14: 35,026,942 I240V probably benign Het
Iqsec3 T A 6: 121,413,313 T400S unknown Het
Itk G A 11: 46,334,908 R539C probably damaging Het
Kdelc1 G T 1: 44,112,764 L322I possibly damaging Het
Kif27 T A 13: 58,326,098 D695V possibly damaging Het
Krt79 T C 15: 101,931,006 probably benign Het
Lama2 C A 10: 27,422,714 V129L possibly damaging Het
Lonrf1 C A 8: 36,229,238 E552D possibly damaging Het
Mpp3 A G 11: 102,000,665 I549T probably benign Het
Nat1 T C 8: 67,491,742 Y260H probably benign Het
Nipal2 T A 15: 34,648,837 K69* probably null Het
Nlrx1 G T 9: 44,256,941 probably benign Het
Pde1b C A 15: 103,521,425 A115E probably benign Het
Pde4dip A G 3: 97,766,494 Y369H probably damaging Het
Pnpla7 A G 2: 25,053,419 Y1286C possibly damaging Het
Pramel5 T C 4: 144,272,959 E186G possibly damaging Het
Qdpr C T 5: 45,450,044 G20D probably damaging Het
Rmnd1 T G 10: 4,407,918 I364L probably benign Het
Slc5a4a A T 10: 76,186,535 E568V probably benign Het
Slc6a18 T A 13: 73,668,271 I330F probably benign Het
Spesp1 T C 9: 62,273,270 T119A possibly damaging Het
Sypl G A 12: 32,975,663 S242N probably benign Het
Tbx18 G A 9: 87,730,717 T43M probably benign Het
Tm7sf2 T A 19: 6,063,926 D263V probably damaging Het
Trbv21 T C 6: 41,202,990 I80T probably damaging Het
Ttc3 T A 16: 94,427,808 L747Q possibly damaging Het
Ttll11 T C 2: 35,817,801 D498G possibly damaging Het
Ttn T C 2: 76,753,370 Y22431C probably null Het
Ubtfl1 T A 9: 18,410,341 S388R Het
Vmn2r118 A T 17: 55,610,835 L226I possibly damaging Het
Wdr46 A G 17: 33,949,182 H576R probably benign Het
Zfp426 A G 9: 20,475,000 F62L probably damaging Het
Other mutations in Gimap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Gimap4 APN 6 48690938 missense probably damaging 1.00
IGL01917:Gimap4 APN 6 48690920 missense probably benign 0.02
IGL02302:Gimap4 APN 6 48690413 missense probably damaging 1.00
IGL02679:Gimap4 APN 6 48690495 nonsense probably null
R1466:Gimap4 UTSW 6 48691282 missense probably benign 0.17
R1466:Gimap4 UTSW 6 48691282 missense probably benign 0.17
R1584:Gimap4 UTSW 6 48691282 missense probably benign 0.17
R2079:Gimap4 UTSW 6 48690947 missense possibly damaging 0.46
R2118:Gimap4 UTSW 6 48690971 missense probably benign 0.24
R2566:Gimap4 UTSW 6 48690865 missense probably damaging 1.00
R4279:Gimap4 UTSW 6 48690577 missense probably benign 0.22
R5592:Gimap4 UTSW 6 48691158 missense probably damaging 0.99
R5597:Gimap4 UTSW 6 48690764 missense probably damaging 1.00
R6162:Gimap4 UTSW 6 48690721 missense probably damaging 0.97
R6354:Gimap4 UTSW 6 48686880 missense possibly damaging 0.53
R6658:Gimap4 UTSW 6 48691404 missense possibly damaging 0.65
R8028:Gimap4 UTSW 6 48690750 missense probably damaging 0.98
R8349:Gimap4 UTSW 6 48690760 missense probably damaging 1.00
R8449:Gimap4 UTSW 6 48690760 missense probably damaging 1.00
R9112:Gimap4 UTSW 6 48690695 missense probably benign 0.00
R9366:Gimap4 UTSW 6 48691103 missense probably benign
R9367:Gimap4 UTSW 6 48690812 missense probably damaging 1.00
X0050:Gimap4 UTSW 6 48690800 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CAAGGAATTCCCCAACTGAGAATTG -3'
(R):5'- AGTCATCCTTCCTGGTGAGC -3'

Sequencing Primer
(F):5'- CCCAACTGAGAATTGTCTTACTTGG -3'
(R):5'- TCCTTCCTGGTGAGCAAGAGAATC -3'
Posted On 2021-10-11