Incidental Mutation 'R8993:Nat1'
ID 684546
Institutional Source Beutler Lab
Gene Symbol Nat1
Ensembl Gene ENSMUSG00000025588
Gene Name N-acetyl transferase 1
Synonyms Nat-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8993 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 67480921-67492104 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 67491742 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 260 (Y260H)
Ref Sequence ENSEMBL: ENSMUSP00000148354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026677] [ENSMUST00000093470] [ENSMUST00000163856] [ENSMUST00000212171]
AlphaFold P50294
Predicted Effect probably benign
Transcript: ENSMUST00000026677
AA Change: Y257H

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000026677
Gene: ENSMUSG00000025588
AA Change: Y257H

DomainStartEndE-ValueType
Pfam:Acetyltransf_2 20 280 1e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093470
SMART Domains Protein: ENSMUSP00000091181
Gene: ENSMUSG00000051147

DomainStartEndE-ValueType
Pfam:Acetyltransf_2 20 280 3.6e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163856
SMART Domains Protein: ENSMUSP00000130065
Gene: ENSMUSG00000051147

DomainStartEndE-ValueType
Pfam:Acetyltransf_2 20 280 3.3e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212171
AA Change: Y260H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that functions to both activate and deactivate arylamine and hydrazine drugs and carcinogens. Polymorphisms in this gene are responsible for the N-acetylation polymorphism in which human populations segregate into rapid, intermediate, and slow acetylator phenotypes. Polymorphisms in this gene are also associated with higher incidences of cancer and drug toxicity. A second arylamine N-acetyltransferase gene (NAT1) is located near this gene (NAT2). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit reduced fertility and a significant reduction in hepatic N-acetyltransferase 1 activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A T 5: 113,703,781 C92* probably null Het
A830018L16Rik G T 1: 11,545,267 E155* probably null Het
Acaa1a A T 9: 119,349,352 probably null Het
Adcy4 T C 14: 55,771,378 E864G probably null Het
Adcy4 T C 14: 55,778,699 D387G probably damaging Het
Ank1 C T 8: 23,098,939 H574Y probably damaging Het
Arhgef16 C T 4: 154,287,038 E233K probably damaging Het
Arhgef26 A T 3: 62,448,104 Y699F probably benign Het
BB014433 C T 8: 15,042,101 V251M probably damaging Het
Bcan G A 3: 87,994,222 A391V probably benign Het
Bod1l A C 5: 41,816,867 V2368G probably benign Het
Braf A G 6: 39,662,151 V222A probably damaging Het
Cd33 G T 7: 43,533,447 probably benign Het
Cdkl2 T A 5: 92,022,151 K324N probably damaging Het
Celf6 A T 9: 59,602,871 T199S probably damaging Het
Cmtm4 A C 8: 104,355,166 D196E probably benign Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Col1a2 C A 6: 4,535,451 P921H unknown Het
Crmp1 T C 5: 37,242,146 M1T probably null Het
Dnah7a A T 1: 53,504,103 Y2303N probably damaging Het
Dock10 G T 1: 80,574,171 T650K probably benign Het
Fam24a A G 7: 131,336,540 D53G probably benign Het
Foxa2 A T 2: 148,044,706 M69K probably benign Het
Gatad2a T A 8: 69,909,935 H601L probably damaging Het
Gimap4 A C 6: 48,690,605 D98A probably damaging Het
Gm14295 G T 2: 176,809,830 R371L possibly damaging Het
Gm5039 A G 12: 88,321,400 F28L probably benign Het
Golim4 G T 3: 75,878,128 A652E probably benign Het
Grid1 A G 14: 35,026,942 I240V probably benign Het
Iqsec3 T A 6: 121,413,313 T400S unknown Het
Itk G A 11: 46,334,908 R539C probably damaging Het
Kdelc1 G T 1: 44,112,764 L322I possibly damaging Het
Kif27 T A 13: 58,326,098 D695V possibly damaging Het
Krt79 T C 15: 101,931,006 probably benign Het
Lama2 C A 10: 27,422,714 V129L possibly damaging Het
Lonrf1 C A 8: 36,229,238 E552D possibly damaging Het
Mpp3 A G 11: 102,000,665 I549T probably benign Het
Nipal2 T A 15: 34,648,837 K69* probably null Het
Nlrx1 G T 9: 44,256,941 probably benign Het
Pde1b C A 15: 103,521,425 A115E probably benign Het
Pde4dip A G 3: 97,766,494 Y369H probably damaging Het
Pnpla7 A G 2: 25,053,419 Y1286C possibly damaging Het
Pramel5 T C 4: 144,272,959 E186G possibly damaging Het
Qdpr C T 5: 45,450,044 G20D probably damaging Het
Rmnd1 T G 10: 4,407,918 I364L probably benign Het
Slc5a4a A T 10: 76,186,535 E568V probably benign Het
Slc6a18 T A 13: 73,668,271 I330F probably benign Het
Spesp1 T C 9: 62,273,270 T119A possibly damaging Het
Sypl G A 12: 32,975,663 S242N probably benign Het
Tbx18 G A 9: 87,730,717 T43M probably benign Het
Tm7sf2 T A 19: 6,063,926 D263V probably damaging Het
Trbv21 T C 6: 41,202,990 I80T probably damaging Het
Ttc3 T A 16: 94,427,808 L747Q possibly damaging Het
Ttll11 T C 2: 35,817,801 D498G possibly damaging Het
Ttn T C 2: 76,753,370 Y22431C probably null Het
Ubtfl1 T A 9: 18,410,341 S388R Het
Vmn2r118 A T 17: 55,610,835 L226I possibly damaging Het
Wdr46 A G 17: 33,949,182 H576R probably benign Het
Zfp426 A G 9: 20,475,000 F62L probably damaging Het
Other mutations in Nat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Nat1 APN 8 67490978 missense possibly damaging 0.84
IGL02004:Nat1 APN 8 67491226 missense probably benign 0.02
IGL02054:Nat1 APN 8 67491422 missense probably damaging 1.00
R0530:Nat1 UTSW 8 67491325 missense probably benign
R0562:Nat1 UTSW 8 67491311 missense possibly damaging 0.56
R1885:Nat1 UTSW 8 67491001 missense probably damaging 1.00
R1924:Nat1 UTSW 8 67491424 missense probably benign 0.00
R3545:Nat1 UTSW 8 67491032 missense possibly damaging 0.91
R3547:Nat1 UTSW 8 67491032 missense possibly damaging 0.91
R5007:Nat1 UTSW 8 67491425 missense probably benign
R5042:Nat1 UTSW 8 67491576 missense probably benign 0.00
R6240:Nat1 UTSW 8 67491702 missense possibly damaging 0.53
R6383:Nat1 UTSW 8 67491482 missense possibly damaging 0.90
R6437:Nat1 UTSW 8 67491736 missense possibly damaging 0.90
R6846:Nat1 UTSW 8 67491343 missense probably benign 0.00
R7108:Nat1 UTSW 8 67491020 missense probably benign
R7164:Nat1 UTSW 8 67491677 missense possibly damaging 0.78
R8199:Nat1 UTSW 8 67490998 missense probably damaging 0.98
R8724:Nat1 UTSW 8 67491791 missense probably damaging 0.99
R9054:Nat1 UTSW 8 67491071 missense probably benign 0.00
Z1177:Nat1 UTSW 8 67491713 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTTGAGCCCCGAGTTATC -3'
(R):5'- TCATTAGTTGGTCAGCATTGGAC -3'

Sequencing Primer
(F):5'- TCGAGGATTTTGAATATGTGAATAGC -3'
(R):5'- CAGCATTGGACTGGGTGATTTC -3'
Posted On 2021-10-11