Incidental Mutation 'R8993:Gatad2a'
ID 684547
Institutional Source Beutler Lab
Gene Symbol Gatad2a
Ensembl Gene ENSMUSG00000036180
Gene Name GATA zinc finger domain containing 2A
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock # R8993 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 69907076-69996384 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 69909935 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 601 (H601L)
Ref Sequence ENSEMBL: ENSMUSP00000070229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065169] [ENSMUST00000116463] [ENSMUST00000177851] [ENSMUST00000212478]
AlphaFold Q8CHY6
Predicted Effect probably damaging
Transcript: ENSMUST00000065169
AA Change: H601L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070229
Gene: ENSMUSG00000036180
AA Change: H601L

DomainStartEndE-ValueType
low complexity region 66 77 N/A INTRINSIC
Pfam:P66_CC 132 175 8.1e-24 PFAM
low complexity region 276 289 N/A INTRINSIC
low complexity region 322 339 N/A INTRINSIC
low complexity region 340 352 N/A INTRINSIC
low complexity region 360 367 N/A INTRINSIC
low complexity region 465 478 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000116463
AA Change: H600L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112164
Gene: ENSMUSG00000036180
AA Change: H600L

DomainStartEndE-ValueType
low complexity region 66 77 N/A INTRINSIC
coiled coil region 135 169 N/A INTRINSIC
low complexity region 275 288 N/A INTRINSIC
low complexity region 321 338 N/A INTRINSIC
low complexity region 339 351 N/A INTRINSIC
low complexity region 359 366 N/A INTRINSIC
low complexity region 464 477 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177851
AA Change: H585L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137386
Gene: ENSMUSG00000036180
AA Change: H585L

DomainStartEndE-ValueType
low complexity region 66 77 N/A INTRINSIC
coiled coil region 135 169 N/A INTRINSIC
low complexity region 275 288 N/A INTRINSIC
low complexity region 321 338 N/A INTRINSIC
low complexity region 339 351 N/A INTRINSIC
low complexity region 359 366 N/A INTRINSIC
low complexity region 464 477 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212478
AA Change: H600L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6354 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die around E9.5 displaying variable developmental defects, including malformed or unfused neural folds, failure of closure of anterior neuropore, missing or excessively large blood vessels in the yolk sac, abnormal embryo turning, and embryonic growth arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A T 5: 113,703,781 C92* probably null Het
A830018L16Rik G T 1: 11,545,267 E155* probably null Het
Acaa1a A T 9: 119,349,352 probably null Het
Adcy4 T C 14: 55,771,378 E864G probably null Het
Adcy4 T C 14: 55,778,699 D387G probably damaging Het
Ank1 C T 8: 23,098,939 H574Y probably damaging Het
Arhgef16 C T 4: 154,287,038 E233K probably damaging Het
Arhgef26 A T 3: 62,448,104 Y699F probably benign Het
BB014433 C T 8: 15,042,101 V251M probably damaging Het
Bcan G A 3: 87,994,222 A391V probably benign Het
Bod1l A C 5: 41,816,867 V2368G probably benign Het
Braf A G 6: 39,662,151 V222A probably damaging Het
Cd33 G T 7: 43,533,447 probably benign Het
Cdkl2 T A 5: 92,022,151 K324N probably damaging Het
Celf6 A T 9: 59,602,871 T199S probably damaging Het
Cmtm4 A C 8: 104,355,166 D196E probably benign Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Col1a2 C A 6: 4,535,451 P921H unknown Het
Crmp1 T C 5: 37,242,146 M1T probably null Het
Dnah7a A T 1: 53,504,103 Y2303N probably damaging Het
Dock10 G T 1: 80,574,171 T650K probably benign Het
Fam24a A G 7: 131,336,540 D53G probably benign Het
Foxa2 A T 2: 148,044,706 M69K probably benign Het
Gimap4 A C 6: 48,690,605 D98A probably damaging Het
Gm14295 G T 2: 176,809,830 R371L possibly damaging Het
Gm5039 A G 12: 88,321,400 F28L probably benign Het
Golim4 G T 3: 75,878,128 A652E probably benign Het
Grid1 A G 14: 35,026,942 I240V probably benign Het
Iqsec3 T A 6: 121,413,313 T400S unknown Het
Itk G A 11: 46,334,908 R539C probably damaging Het
Kdelc1 G T 1: 44,112,764 L322I possibly damaging Het
Kif27 T A 13: 58,326,098 D695V possibly damaging Het
Krt79 T C 15: 101,931,006 probably benign Het
Lama2 C A 10: 27,422,714 V129L possibly damaging Het
Lonrf1 C A 8: 36,229,238 E552D possibly damaging Het
Mpp3 A G 11: 102,000,665 I549T probably benign Het
Nat1 T C 8: 67,491,742 Y260H probably benign Het
Nipal2 T A 15: 34,648,837 K69* probably null Het
Nlrx1 G T 9: 44,256,941 probably benign Het
Pde1b C A 15: 103,521,425 A115E probably benign Het
Pde4dip A G 3: 97,766,494 Y369H probably damaging Het
Pnpla7 A G 2: 25,053,419 Y1286C possibly damaging Het
Pramel5 T C 4: 144,272,959 E186G possibly damaging Het
Qdpr C T 5: 45,450,044 G20D probably damaging Het
Rmnd1 T G 10: 4,407,918 I364L probably benign Het
Slc5a4a A T 10: 76,186,535 E568V probably benign Het
Slc6a18 T A 13: 73,668,271 I330F probably benign Het
Spesp1 T C 9: 62,273,270 T119A possibly damaging Het
Sypl G A 12: 32,975,663 S242N probably benign Het
Tbx18 G A 9: 87,730,717 T43M probably benign Het
Tm7sf2 T A 19: 6,063,926 D263V probably damaging Het
Trbv21 T C 6: 41,202,990 I80T probably damaging Het
Ttc3 T A 16: 94,427,808 L747Q possibly damaging Het
Ttll11 T C 2: 35,817,801 D498G possibly damaging Het
Ttn T C 2: 76,753,370 Y22431C probably null Het
Ubtfl1 T A 9: 18,410,341 S388R Het
Vmn2r118 A T 17: 55,610,835 L226I possibly damaging Het
Wdr46 A G 17: 33,949,182 H576R probably benign Het
Zfp426 A G 9: 20,475,000 F62L probably damaging Het
Other mutations in Gatad2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01960:Gatad2a APN 8 69909948 missense possibly damaging 0.94
R1730:Gatad2a UTSW 8 69909936 missense probably damaging 1.00
R1783:Gatad2a UTSW 8 69909936 missense probably damaging 1.00
R1894:Gatad2a UTSW 8 69916651 missense probably damaging 1.00
R1982:Gatad2a UTSW 8 69913132 nonsense probably null
R3762:Gatad2a UTSW 8 69916280 splice site probably null
R5241:Gatad2a UTSW 8 69918017 nonsense probably null
R5526:Gatad2a UTSW 8 69935941 missense probably damaging 1.00
R5532:Gatad2a UTSW 8 69916420 missense probably damaging 1.00
R6664:Gatad2a UTSW 8 69917489 missense probably damaging 1.00
R7036:Gatad2a UTSW 8 69917994 missense probably damaging 1.00
Z1176:Gatad2a UTSW 8 69936038 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACTCTCCTGGCCAAAGCAAG -3'
(R):5'- ACTTAGGTCACCTCTGTGGG -3'

Sequencing Primer
(F):5'- CAAGGCCTGAGCTGTCTC -3'
(R):5'- AGGTCACCTCTGTGGGATCTG -3'
Posted On 2021-10-11