Incidental Mutation 'R8993:Ubtfl1'
ID 684549
Institutional Source Beutler Lab
Gene Symbol Ubtfl1
Ensembl Gene ENSMUSG00000074502
Gene Name upstream binding transcription factor, RNA polymerase I-like 1
Synonyms B020006M18Rik, Hmgpi
MMRRC Submission 068824-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.132) question?
Stock # R8993 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 18315714-18322798 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 18321637 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 388 (S388R)
Ref Sequence ENSEMBL: ENSMUSP00000129611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098973] [ENSMUST00000164441] [ENSMUST00000169398]
AlphaFold Q3USZ2
Predicted Effect unknown
Transcript: ENSMUST00000098973
AA Change: S388R
SMART Domains Protein: ENSMUSP00000096572
Gene: ENSMUSG00000074502
AA Change: S388R

DomainStartEndE-ValueType
Blast:SANT 6 64 1e-17 BLAST
HMG 100 170 5.61e-16 SMART
HMG 224 292 3.79e-4 SMART
low complexity region 297 307 N/A INTRINSIC
low complexity region 373 394 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000129611
Gene: ENSMUSG00000074502
AA Change: S388R

DomainStartEndE-ValueType
Blast:SANT 6 64 1e-17 BLAST
HMG 100 170 5.61e-16 SMART
HMG 224 292 3.79e-4 SMART
low complexity region 297 307 N/A INTRINSIC
low complexity region 373 394 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000169398
AA Change: S388R
SMART Domains Protein: ENSMUSP00000126540
Gene: ENSMUSG00000074502
AA Change: S388R

DomainStartEndE-ValueType
Blast:SANT 6 64 1e-17 BLAST
HMG 100 170 5.61e-16 SMART
HMG 224 292 3.79e-4 SMART
low complexity region 297 307 N/A INTRINSIC
low complexity region 373 394 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A T 5: 113,841,842 (GRCm39) C92* probably null Het
A830018L16Rik G T 1: 11,615,491 (GRCm39) E155* probably null Het
Acaa1a A T 9: 119,178,418 (GRCm39) probably null Het
Adcy4 T C 14: 56,008,835 (GRCm39) E864G probably null Het
Adcy4 T C 14: 56,016,156 (GRCm39) D387G probably damaging Het
Ank1 C T 8: 23,588,955 (GRCm39) H574Y probably damaging Het
Arhgef16 C T 4: 154,371,495 (GRCm39) E233K probably damaging Het
Arhgef26 A T 3: 62,355,525 (GRCm39) Y699F probably benign Het
BB014433 C T 8: 15,092,101 (GRCm39) V251M probably damaging Het
Bcan G A 3: 87,901,529 (GRCm39) A391V probably benign Het
Bod1l A C 5: 41,974,210 (GRCm39) V2368G probably benign Het
Braf A G 6: 39,639,085 (GRCm39) V222A probably damaging Het
Cd33 G T 7: 43,182,871 (GRCm39) probably benign Het
Cdkl2 T A 5: 92,170,010 (GRCm39) K324N probably damaging Het
Celf6 A T 9: 59,510,154 (GRCm39) T199S probably damaging Het
Cmtm4 A C 8: 105,081,798 (GRCm39) D196E probably benign Het
Cntn1 G A 15: 92,132,347 (GRCm39) V148M probably damaging Het
Col1a2 C A 6: 4,535,451 (GRCm39) P921H unknown Het
Crmp1 T C 5: 37,399,490 (GRCm39) M1T probably null Het
Dnah7a A T 1: 53,543,262 (GRCm39) Y2303N probably damaging Het
Dock10 G T 1: 80,551,888 (GRCm39) T650K probably benign Het
Eif1ad15 A G 12: 88,288,170 (GRCm39) F28L probably benign Het
Fam24a A G 7: 130,938,269 (GRCm39) D53G probably benign Het
Foxa2 A T 2: 147,886,626 (GRCm39) M69K probably benign Het
Gatad2a T A 8: 70,362,585 (GRCm39) H601L probably damaging Het
Gimap4 A C 6: 48,667,539 (GRCm39) D98A probably damaging Het
Gm14295 G T 2: 176,501,623 (GRCm39) R371L possibly damaging Het
Golim4 G T 3: 75,785,435 (GRCm39) A652E probably benign Het
Grid1 A G 14: 34,748,899 (GRCm39) I240V probably benign Het
Iqsec3 T A 6: 121,390,272 (GRCm39) T400S unknown Het
Itk G A 11: 46,225,735 (GRCm39) R539C probably damaging Het
Kif27 T A 13: 58,473,912 (GRCm39) D695V possibly damaging Het
Krt79 T C 15: 101,839,441 (GRCm39) probably benign Het
Lama2 C A 10: 27,298,710 (GRCm39) V129L possibly damaging Het
Lonrf1 C A 8: 36,696,392 (GRCm39) E552D possibly damaging Het
Mpp3 A G 11: 101,891,491 (GRCm39) I549T probably benign Het
Nat1 T C 8: 67,944,394 (GRCm39) Y260H probably benign Het
Nipal2 T A 15: 34,648,983 (GRCm39) K69* probably null Het
Nlrx1 G T 9: 44,168,238 (GRCm39) probably benign Het
Pde1b C A 15: 103,429,852 (GRCm39) A115E probably benign Het
Pde4dip A G 3: 97,673,810 (GRCm39) Y369H probably damaging Het
Pnpla7 A G 2: 24,943,431 (GRCm39) Y1286C possibly damaging Het
Poglut2 G T 1: 44,151,924 (GRCm39) L322I possibly damaging Het
Pramel5 T C 4: 143,999,529 (GRCm39) E186G possibly damaging Het
Qdpr C T 5: 45,607,386 (GRCm39) G20D probably damaging Het
Rmnd1 T G 10: 4,357,918 (GRCm39) I364L probably benign Het
Slc5a4a A T 10: 76,022,369 (GRCm39) E568V probably benign Het
Slc6a18 T A 13: 73,816,390 (GRCm39) I330F probably benign Het
Spesp1 T C 9: 62,180,552 (GRCm39) T119A possibly damaging Het
Sypl1 G A 12: 33,025,662 (GRCm39) S242N probably benign Het
Tbx18 G A 9: 87,612,770 (GRCm39) T43M probably benign Het
Tm7sf2 T A 19: 6,113,956 (GRCm39) D263V probably damaging Het
Trbv21 T C 6: 41,179,924 (GRCm39) I80T probably damaging Het
Ttc3 T A 16: 94,228,667 (GRCm39) L747Q possibly damaging Het
Ttll11 T C 2: 35,707,813 (GRCm39) D498G possibly damaging Het
Ttn T C 2: 76,583,714 (GRCm39) Y22431C probably null Het
Vmn2r118 A T 17: 55,917,835 (GRCm39) L226I possibly damaging Het
Wdr46 A G 17: 34,168,156 (GRCm39) H576R probably benign Het
Zfp426 A G 9: 20,386,296 (GRCm39) F62L probably damaging Het
Other mutations in Ubtfl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01886:Ubtfl1 APN 9 18,321,017 (GRCm39) missense possibly damaging 0.93
IGL02028:Ubtfl1 APN 9 18,320,849 (GRCm39) missense possibly damaging 0.83
R0112:Ubtfl1 UTSW 9 18,321,083 (GRCm39) missense probably benign 0.24
R0600:Ubtfl1 UTSW 9 18,320,660 (GRCm39) missense probably damaging 1.00
R1450:Ubtfl1 UTSW 9 18,321,209 (GRCm39) missense possibly damaging 0.54
R1511:Ubtfl1 UTSW 9 18,321,489 (GRCm39) missense probably benign 0.00
R2007:Ubtfl1 UTSW 9 18,320,547 (GRCm39) missense possibly damaging 0.93
R3611:Ubtfl1 UTSW 9 18,320,661 (GRCm39) missense probably damaging 1.00
R3836:Ubtfl1 UTSW 9 18,320,533 (GRCm39) missense possibly damaging 0.67
R4088:Ubtfl1 UTSW 9 18,321,264 (GRCm39) missense probably damaging 0.98
R4577:Ubtfl1 UTSW 9 18,320,789 (GRCm39) missense probably damaging 1.00
R5057:Ubtfl1 UTSW 9 18,320,487 (GRCm39) missense possibly damaging 0.83
R5224:Ubtfl1 UTSW 9 18,321,326 (GRCm39) missense probably benign 0.34
R5284:Ubtfl1 UTSW 9 18,320,741 (GRCm39) nonsense probably null
R5965:Ubtfl1 UTSW 9 18,320,838 (GRCm39) missense probably benign 0.04
R6261:Ubtfl1 UTSW 9 18,320,592 (GRCm39) missense possibly damaging 0.65
R6449:Ubtfl1 UTSW 9 18,320,925 (GRCm39) missense possibly damaging 0.88
R6951:Ubtfl1 UTSW 9 18,320,873 (GRCm39) missense probably benign 0.03
R7130:Ubtfl1 UTSW 9 18,321,143 (GRCm39) missense probably damaging 1.00
R7133:Ubtfl1 UTSW 9 18,320,931 (GRCm39) missense probably damaging 1.00
R7664:Ubtfl1 UTSW 9 18,320,782 (GRCm39) missense possibly damaging 0.66
R7718:Ubtfl1 UTSW 9 18,320,527 (GRCm39) missense possibly damaging 0.77
R8171:Ubtfl1 UTSW 9 18,320,523 (GRCm39) missense probably benign 0.09
R8789:Ubtfl1 UTSW 9 18,321,609 (GRCm39) missense unknown
R8811:Ubtfl1 UTSW 9 18,321,459 (GRCm39) missense probably benign
R9536:Ubtfl1 UTSW 9 18,320,537 (GRCm39) missense probably benign 0.10
Z1177:Ubtfl1 UTSW 9 18,320,963 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGTCCTCCTCAGAGAAAG -3'
(R):5'- TGCTATGGCAAACTCCCTTC -3'

Sequencing Primer
(F):5'- GGCCTTCAAATAAAGCCTGG -3'
(R):5'- ACTCCTTTGTATTTAGTAGCAAAGG -3'
Posted On 2021-10-11