Incidental Mutation 'R8993:Tbx18'
ID 684553
Institutional Source Beutler Lab
Gene Symbol Tbx18
Ensembl Gene ENSMUSG00000032419
Gene Name T-box18
Synonyms 2810404D13Rik, 2810012F10Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8993 (G1)
Quality Score 126.008
Status Validated
Chromosome 9
Chromosomal Location 87702800-87731260 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 87730717 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 43 (T43M)
Ref Sequence ENSEMBL: ENSMUSP00000034991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034991]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000034991
AA Change: T43M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034991
Gene: ENSMUSG00000032419
AA Change: T43M

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
low complexity region 67 87 N/A INTRINSIC
low complexity region 113 132 N/A INTRINSIC
TBOX 144 341 8.7e-127 SMART
low complexity region 461 476 N/A INTRINSIC
low complexity region 555 567 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This genes codes for a member of an evolutionarily conserved family of transcription factors that plays a crucial role in embryonic development. The family is characterized by the presence of the DNA-binding T-box domain and is divided into five sub-families based on sequence conservation in this domain. The encoded protein belongs to the vertebrate specific Tbx1 sub-family. The protein acts as a transcriptional repressor by antagonizing transcriptional activators in the T-box family. The protein forms homo- or heterodimers with other transcription factors of the T-box family or other transcription factors. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous null mice fail to maintain anterior-posterior polarity of the lateral sclerotome and display neonatal lethality and abnormal vertebral, rib and spinal nerve morphology. Mice homozygous for another targeted allele exhibit neonatal lethality, abnormal skeleton and abnormal coronary vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A T 5: 113,703,781 C92* probably null Het
A830018L16Rik G T 1: 11,545,267 E155* probably null Het
Acaa1a A T 9: 119,349,352 probably null Het
Adcy4 T C 14: 55,771,378 E864G probably null Het
Adcy4 T C 14: 55,778,699 D387G probably damaging Het
Ank1 C T 8: 23,098,939 H574Y probably damaging Het
Arhgef16 C T 4: 154,287,038 E233K probably damaging Het
Arhgef26 A T 3: 62,448,104 Y699F probably benign Het
BB014433 C T 8: 15,042,101 V251M probably damaging Het
Bcan G A 3: 87,994,222 A391V probably benign Het
Bod1l A C 5: 41,816,867 V2368G probably benign Het
Braf A G 6: 39,662,151 V222A probably damaging Het
Cd33 G T 7: 43,533,447 probably benign Het
Cdkl2 T A 5: 92,022,151 K324N probably damaging Het
Celf6 A T 9: 59,602,871 T199S probably damaging Het
Cmtm4 A C 8: 104,355,166 D196E probably benign Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Col1a2 C A 6: 4,535,451 P921H unknown Het
Crmp1 T C 5: 37,242,146 M1T probably null Het
Dnah7a A T 1: 53,504,103 Y2303N probably damaging Het
Dock10 G T 1: 80,574,171 T650K probably benign Het
Fam24a A G 7: 131,336,540 D53G probably benign Het
Foxa2 A T 2: 148,044,706 M69K probably benign Het
Gatad2a T A 8: 69,909,935 H601L probably damaging Het
Gimap4 A C 6: 48,690,605 D98A probably damaging Het
Gm14295 G T 2: 176,809,830 R371L possibly damaging Het
Gm5039 A G 12: 88,321,400 F28L probably benign Het
Golim4 G T 3: 75,878,128 A652E probably benign Het
Grid1 A G 14: 35,026,942 I240V probably benign Het
Iqsec3 T A 6: 121,413,313 T400S unknown Het
Itk G A 11: 46,334,908 R539C probably damaging Het
Kdelc1 G T 1: 44,112,764 L322I possibly damaging Het
Kif27 T A 13: 58,326,098 D695V possibly damaging Het
Krt79 T C 15: 101,931,006 probably benign Het
Lama2 C A 10: 27,422,714 V129L possibly damaging Het
Lonrf1 C A 8: 36,229,238 E552D possibly damaging Het
Mpp3 A G 11: 102,000,665 I549T probably benign Het
Nat1 T C 8: 67,491,742 Y260H probably benign Het
Nipal2 T A 15: 34,648,837 K69* probably null Het
Nlrx1 G T 9: 44,256,941 probably benign Het
Pde1b C A 15: 103,521,425 A115E probably benign Het
Pde4dip A G 3: 97,766,494 Y369H probably damaging Het
Pnpla7 A G 2: 25,053,419 Y1286C possibly damaging Het
Pramel5 T C 4: 144,272,959 E186G possibly damaging Het
Qdpr C T 5: 45,450,044 G20D probably damaging Het
Rmnd1 T G 10: 4,407,918 I364L probably benign Het
Slc5a4a A T 10: 76,186,535 E568V probably benign Het
Slc6a18 T A 13: 73,668,271 I330F probably benign Het
Spesp1 T C 9: 62,273,270 T119A possibly damaging Het
Sypl G A 12: 32,975,663 S242N probably benign Het
Tm7sf2 T A 19: 6,063,926 D263V probably damaging Het
Trbv21 T C 6: 41,202,990 I80T probably damaging Het
Ttc3 T A 16: 94,427,808 L747Q possibly damaging Het
Ttll11 T C 2: 35,817,801 D498G possibly damaging Het
Ttn T C 2: 76,753,370 Y22431C probably null Het
Ubtfl1 T A 9: 18,410,341 S388R Het
Vmn2r118 A T 17: 55,610,835 L226I possibly damaging Het
Wdr46 A G 17: 33,949,182 H576R probably benign Het
Zfp426 A G 9: 20,475,000 F62L probably damaging Het
Other mutations in Tbx18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Tbx18 APN 9 87705623 missense possibly damaging 0.90
IGL00832:Tbx18 APN 9 87705661 missense probably damaging 1.00
IGL01287:Tbx18 APN 9 87724331 missense probably damaging 0.98
IGL01406:Tbx18 APN 9 87713543 missense probably damaging 0.99
IGL01587:Tbx18 APN 9 87724408 missense probably damaging 0.99
IGL01898:Tbx18 APN 9 87707859 missense possibly damaging 0.92
IGL02624:Tbx18 APN 9 87727406 missense probably damaging 1.00
IGL03057:Tbx18 APN 9 87730829 missense probably damaging 0.99
IGL03252:Tbx18 APN 9 87705580 missense probably damaging 1.00
R0126:Tbx18 UTSW 9 87729653 missense possibly damaging 0.50
R0243:Tbx18 UTSW 9 87715516 splice site probably benign
R0374:Tbx18 UTSW 9 87724355 missense probably damaging 0.97
R0666:Tbx18 UTSW 9 87724409 missense probably benign 0.13
R2141:Tbx18 UTSW 9 87715653 missense probably damaging 0.99
R2183:Tbx18 UTSW 9 87705736 missense probably damaging 0.98
R2233:Tbx18 UTSW 9 87724350 missense probably damaging 1.00
R2234:Tbx18 UTSW 9 87724350 missense probably damaging 1.00
R2235:Tbx18 UTSW 9 87724350 missense probably damaging 1.00
R3835:Tbx18 UTSW 9 87729636 missense probably benign
R4214:Tbx18 UTSW 9 87724465 missense probably damaging 1.00
R4606:Tbx18 UTSW 9 87730769 missense possibly damaging 0.84
R4834:Tbx18 UTSW 9 87727449 missense possibly damaging 0.48
R5112:Tbx18 UTSW 9 87715687 missense probably damaging 1.00
R5887:Tbx18 UTSW 9 87713513 missense possibly damaging 0.58
R6628:Tbx18 UTSW 9 87715535 nonsense probably null
R6659:Tbx18 UTSW 9 87707811 missense probably damaging 1.00
R7001:Tbx18 UTSW 9 87727404 missense probably damaging 1.00
R7057:Tbx18 UTSW 9 87705264 missense possibly damaging 0.94
R7167:Tbx18 UTSW 9 87707830 missense probably damaging 1.00
R7368:Tbx18 UTSW 9 87730697 missense probably benign
R8147:Tbx18 UTSW 9 87724358 missense probably damaging 0.97
R9263:Tbx18 UTSW 9 87729468 missense probably damaging 0.97
R9291:Tbx18 UTSW 9 87729482 missense probably damaging 1.00
R9396:Tbx18 UTSW 9 87727379 missense probably damaging 1.00
R9420:Tbx18 UTSW 9 87730622 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGGGATCGATCGACTCACC -3'
(R):5'- GTGCATCATTGAACTCGAGGG -3'

Sequencing Primer
(F):5'- GATCGACTCACCCGCCG -3'
(R):5'- TTTTGCCCGCAGCTAGGAAG -3'
Posted On 2021-10-11