Incidental Mutation 'R8993:Acaa1a'
ID 684554
Institutional Source Beutler Lab
Gene Symbol Acaa1a
Ensembl Gene ENSMUSG00000036138
Gene Name acetyl-Coenzyme A acyltransferase 1A
Synonyms thiolase A, PTL, peroxisomal 3-ketoacyl-CoA thiolase, Acaa1, D9Ertd25e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8993 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 119339676-119350299 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to T at 119349352 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000042351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039784] [ENSMUST00000170400] [ENSMUST00000175743] [ENSMUST00000176397] [ENSMUST00000176546] [ENSMUST00000177463]
AlphaFold Q921H8
Predicted Effect probably null
Transcript: ENSMUST00000039784
SMART Domains Protein: ENSMUSP00000042351
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 38 291 3.6e-88 PFAM
Pfam:Thiolase_C 298 421 3e-53 PFAM
Pfam:ACP_syn_III_C 329 420 1.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170400
SMART Domains Protein: ENSMUSP00000131982
Gene: ENSMUSG00000070280

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Sugar_tr 150 555 1.2e-28 PFAM
Pfam:MFS_1 178 514 7.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175743
SMART Domains Protein: ENSMUSP00000135439
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 35 291 4.2e-90 PFAM
Pfam:Thiolase_C 298 337 8.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176397
SMART Domains Protein: ENSMUSP00000135191
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 35 152 4.9e-38 PFAM
Pfam:Thiolase_N 148 246 4.8e-34 PFAM
Pfam:Thiolase_C 214 328 5.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176546
SMART Domains Protein: ENSMUSP00000134981
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 1 110 4.1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177463
SMART Domains Protein: ENSMUSP00000135310
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 35 199 3.2e-50 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme operative in the beta-oxidation system of the peroxisomes. Deficiency of this enzyme leads to pseudo-Zellweger syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A T 5: 113,703,781 C92* probably null Het
A830018L16Rik G T 1: 11,545,267 E155* probably null Het
Adcy4 T C 14: 55,771,378 E864G probably null Het
Adcy4 T C 14: 55,778,699 D387G probably damaging Het
Ank1 C T 8: 23,098,939 H574Y probably damaging Het
Arhgef16 C T 4: 154,287,038 E233K probably damaging Het
Arhgef26 A T 3: 62,448,104 Y699F probably benign Het
BB014433 C T 8: 15,042,101 V251M probably damaging Het
Bcan G A 3: 87,994,222 A391V probably benign Het
Bod1l A C 5: 41,816,867 V2368G probably benign Het
Braf A G 6: 39,662,151 V222A probably damaging Het
Cd33 G T 7: 43,533,447 probably benign Het
Cdkl2 T A 5: 92,022,151 K324N probably damaging Het
Celf6 A T 9: 59,602,871 T199S probably damaging Het
Cmtm4 A C 8: 104,355,166 D196E probably benign Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Col1a2 C A 6: 4,535,451 P921H unknown Het
Crmp1 T C 5: 37,242,146 M1T probably null Het
Dnah7a A T 1: 53,504,103 Y2303N probably damaging Het
Dock10 G T 1: 80,574,171 T650K probably benign Het
Fam24a A G 7: 131,336,540 D53G probably benign Het
Foxa2 A T 2: 148,044,706 M69K probably benign Het
Gatad2a T A 8: 69,909,935 H601L probably damaging Het
Gimap4 A C 6: 48,690,605 D98A probably damaging Het
Gm14295 G T 2: 176,809,830 R371L possibly damaging Het
Gm5039 A G 12: 88,321,400 F28L probably benign Het
Golim4 G T 3: 75,878,128 A652E probably benign Het
Grid1 A G 14: 35,026,942 I240V probably benign Het
Iqsec3 T A 6: 121,413,313 T400S unknown Het
Itk G A 11: 46,334,908 R539C probably damaging Het
Kdelc1 G T 1: 44,112,764 L322I possibly damaging Het
Kif27 T A 13: 58,326,098 D695V possibly damaging Het
Krt79 T C 15: 101,931,006 probably benign Het
Lama2 C A 10: 27,422,714 V129L possibly damaging Het
Lonrf1 C A 8: 36,229,238 E552D possibly damaging Het
Mpp3 A G 11: 102,000,665 I549T probably benign Het
Nat1 T C 8: 67,491,742 Y260H probably benign Het
Nipal2 T A 15: 34,648,837 K69* probably null Het
Nlrx1 G T 9: 44,256,941 probably benign Het
Pde1b C A 15: 103,521,425 A115E probably benign Het
Pde4dip A G 3: 97,766,494 Y369H probably damaging Het
Pnpla7 A G 2: 25,053,419 Y1286C possibly damaging Het
Pramel5 T C 4: 144,272,959 E186G possibly damaging Het
Qdpr C T 5: 45,450,044 G20D probably damaging Het
Rmnd1 T G 10: 4,407,918 I364L probably benign Het
Slc5a4a A T 10: 76,186,535 E568V probably benign Het
Slc6a18 T A 13: 73,668,271 I330F probably benign Het
Spesp1 T C 9: 62,273,270 T119A possibly damaging Het
Sypl G A 12: 32,975,663 S242N probably benign Het
Tbx18 G A 9: 87,730,717 T43M probably benign Het
Tm7sf2 T A 19: 6,063,926 D263V probably damaging Het
Trbv21 T C 6: 41,202,990 I80T probably damaging Het
Ttc3 T A 16: 94,427,808 L747Q possibly damaging Het
Ttll11 T C 2: 35,817,801 D498G possibly damaging Het
Ttn T C 2: 76,753,370 Y22431C probably null Het
Ubtfl1 T A 9: 18,410,341 S388R Het
Vmn2r118 A T 17: 55,610,835 L226I possibly damaging Het
Wdr46 A G 17: 33,949,182 H576R probably benign Het
Zfp426 A G 9: 20,475,000 F62L probably damaging Het
Other mutations in Acaa1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0632:Acaa1a UTSW 9 119347818 unclassified probably benign
R3418:Acaa1a UTSW 9 119349490 critical splice acceptor site probably null
R4617:Acaa1a UTSW 9 119348940 missense probably damaging 1.00
R4908:Acaa1a UTSW 9 119348706 missense probably benign
R4912:Acaa1a UTSW 9 119342761 missense probably damaging 1.00
R6351:Acaa1a UTSW 9 119341564 nonsense probably null
R6586:Acaa1a UTSW 9 119349538 splice site probably null
R7040:Acaa1a UTSW 9 119349038 missense probably damaging 1.00
R7500:Acaa1a UTSW 9 119344498 missense probably benign 0.00
R9173:Acaa1a UTSW 9 119341124 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGCTTGGATCCTGCAAGACC -3'
(R):5'- AGGAATTCCTAGCTTCTCCACAC -3'

Sequencing Primer
(F):5'- GATCCTGCAAGACCTGTATCTGG -3'
(R):5'- TAGCTTCTCCACACAGTAGACGG -3'
Posted On 2021-10-11