Incidental Mutation 'R8993:Rmnd1'
ID 684555
Institutional Source Beutler Lab
Gene Symbol Rmnd1
Ensembl Gene ENSMUSG00000019763
Gene Name required for meiotic nuclear division 1 homolog
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.344) question?
Stock # R8993 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 4401915-4432388 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 4407918 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 364 (I364L)
Ref Sequence ENSEMBL: ENSMUSP00000043355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042251] [ENSMUST00000128434]
AlphaFold Q8CI78
Predicted Effect probably benign
Transcript: ENSMUST00000042251
AA Change: I364L

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000043355
Gene: ENSMUSG00000019763
AA Change: I364L

DomainStartEndE-ValueType
Pfam:DUF155 227 404 3.2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128434
AA Change: I1L

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119195
Gene: ENSMUSG00000019763
AA Change: I1L

DomainStartEndE-ValueType
Pfam:DUF155 1 42 8.4e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the evolutionary conserved sif2 family of proteins that share the DUF155 domain in common. This protein is thought to be localized in the mitochondria and involved in mitochondrial translation. Mutations in this gene are associated with combined oxidative phosphorylation deficiency-11. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A T 5: 113,703,781 C92* probably null Het
A830018L16Rik G T 1: 11,545,267 E155* probably null Het
Acaa1a A T 9: 119,349,352 probably null Het
Adcy4 T C 14: 55,771,378 E864G probably null Het
Adcy4 T C 14: 55,778,699 D387G probably damaging Het
Ank1 C T 8: 23,098,939 H574Y probably damaging Het
Arhgef16 C T 4: 154,287,038 E233K probably damaging Het
Arhgef26 A T 3: 62,448,104 Y699F probably benign Het
BB014433 C T 8: 15,042,101 V251M probably damaging Het
Bcan G A 3: 87,994,222 A391V probably benign Het
Bod1l A C 5: 41,816,867 V2368G probably benign Het
Braf A G 6: 39,662,151 V222A probably damaging Het
Cd33 G T 7: 43,533,447 probably benign Het
Cdkl2 T A 5: 92,022,151 K324N probably damaging Het
Celf6 A T 9: 59,602,871 T199S probably damaging Het
Cmtm4 A C 8: 104,355,166 D196E probably benign Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Col1a2 C A 6: 4,535,451 P921H unknown Het
Crmp1 T C 5: 37,242,146 M1T probably null Het
Dnah7a A T 1: 53,504,103 Y2303N probably damaging Het
Dock10 G T 1: 80,574,171 T650K probably benign Het
Fam24a A G 7: 131,336,540 D53G probably benign Het
Foxa2 A T 2: 148,044,706 M69K probably benign Het
Gatad2a T A 8: 69,909,935 H601L probably damaging Het
Gimap4 A C 6: 48,690,605 D98A probably damaging Het
Gm14295 G T 2: 176,809,830 R371L possibly damaging Het
Gm5039 A G 12: 88,321,400 F28L probably benign Het
Golim4 G T 3: 75,878,128 A652E probably benign Het
Grid1 A G 14: 35,026,942 I240V probably benign Het
Iqsec3 T A 6: 121,413,313 T400S unknown Het
Itk G A 11: 46,334,908 R539C probably damaging Het
Kdelc1 G T 1: 44,112,764 L322I possibly damaging Het
Kif27 T A 13: 58,326,098 D695V possibly damaging Het
Krt79 T C 15: 101,931,006 probably benign Het
Lama2 C A 10: 27,422,714 V129L possibly damaging Het
Lonrf1 C A 8: 36,229,238 E552D possibly damaging Het
Mpp3 A G 11: 102,000,665 I549T probably benign Het
Nat1 T C 8: 67,491,742 Y260H probably benign Het
Nipal2 T A 15: 34,648,837 K69* probably null Het
Nlrx1 G T 9: 44,256,941 probably benign Het
Pde1b C A 15: 103,521,425 A115E probably benign Het
Pde4dip A G 3: 97,766,494 Y369H probably damaging Het
Pnpla7 A G 2: 25,053,419 Y1286C possibly damaging Het
Pramel5 T C 4: 144,272,959 E186G possibly damaging Het
Qdpr C T 5: 45,450,044 G20D probably damaging Het
Slc5a4a A T 10: 76,186,535 E568V probably benign Het
Slc6a18 T A 13: 73,668,271 I330F probably benign Het
Spesp1 T C 9: 62,273,270 T119A possibly damaging Het
Sypl G A 12: 32,975,663 S242N probably benign Het
Tbx18 G A 9: 87,730,717 T43M probably benign Het
Tm7sf2 T A 19: 6,063,926 D263V probably damaging Het
Trbv21 T C 6: 41,202,990 I80T probably damaging Het
Ttc3 T A 16: 94,427,808 L747Q possibly damaging Het
Ttll11 T C 2: 35,817,801 D498G possibly damaging Het
Ttn T C 2: 76,753,370 Y22431C probably null Het
Ubtfl1 T A 9: 18,410,341 S388R Het
Vmn2r118 A T 17: 55,610,835 L226I possibly damaging Het
Wdr46 A G 17: 33,949,182 H576R probably benign Het
Zfp426 A G 9: 20,475,000 F62L probably damaging Het
Other mutations in Rmnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Rmnd1 APN 10 4427392 missense probably benign
IGL01018:Rmnd1 APN 10 4427290 missense probably benign 0.43
IGL01112:Rmnd1 APN 10 4410793 splice site probably null
R0418:Rmnd1 UTSW 10 4427693 critical splice acceptor site probably null
R2036:Rmnd1 UTSW 10 4407884 missense probably damaging 1.00
R2312:Rmnd1 UTSW 10 4427466 missense probably benign
R2319:Rmnd1 UTSW 10 4422099 missense possibly damaging 0.62
R4191:Rmnd1 UTSW 10 4410809 unclassified probably benign
R5077:Rmnd1 UTSW 10 4427488 missense possibly damaging 0.66
R5620:Rmnd1 UTSW 10 4422159 missense probably damaging 1.00
R5659:Rmnd1 UTSW 10 4427382 missense probably benign 0.04
R6291:Rmnd1 UTSW 10 4422135 missense probably damaging 1.00
R7089:Rmnd1 UTSW 10 4403873 missense probably damaging 1.00
R7214:Rmnd1 UTSW 10 4410753 missense probably benign
R7260:Rmnd1 UTSW 10 4414803 splice site probably null
R7540:Rmnd1 UTSW 10 4403989 missense probably damaging 1.00
R7599:Rmnd1 UTSW 10 4413404 missense probably benign 0.11
R7719:Rmnd1 UTSW 10 4427496 missense probably benign
R7777:Rmnd1 UTSW 10 4411713 missense probably damaging 1.00
R7809:Rmnd1 UTSW 10 4407848 missense probably damaging 1.00
R8397:Rmnd1 UTSW 10 4427278 nonsense probably null
R9058:Rmnd1 UTSW 10 4413398 missense probably benign 0.05
X0026:Rmnd1 UTSW 10 4427676 start codon destroyed probably null 0.99
Predicted Primers PCR Primer
(F):5'- AGAGCAACTGTCCTGTCTGTC -3'
(R):5'- TCTTGTGGTTGCGTAACGAC -3'

Sequencing Primer
(F):5'- GAAACCCTGCCCAAGTGTAG -3'
(R):5'- GAAAAGTGAGGCTTATTGTGTTACC -3'
Posted On 2021-10-11