Mutagenetix > Incidental Mutations

Incidental Mutation 'R8993:Itk'

684558

Institutional Source

Beutler Lab

Gene Symbol

Itk

Ensembl Gene

ENSMUSG00000020395

Gene Name

IL2 inducible T cell kinase

Synonyms

Emt, Tsk, Tcsk

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.131) question?

Stock #

R8993 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

46325150-46389515 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 46334908 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 539 (R539C)

Ref Sequence

ENSEMBL: ENSMUSP00000104860 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020664] [ENSMUST00000109237]

AlphaFold

Q03526

PDB Structure

INTRAMOLECULAR ITK-PROLINE COMPLEX, NMR, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
NMR Structures of Itk SH2 domain, Pro287cis isoform, ensemble of 20 low energy structures [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287cis, Energy minimized average structure [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287trans, 20 low energy structures [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287trans, energy minimized average structure [SOLUTION NMR]
The NMR minimized average structure of the Itk SH2 domain bound to a phosphopeptide [SOLUTION NMR]
The NMR ensemble structure of the Itk SH2 domain bound to a phosphopeptide [SOLUTION NMR]
Solution Structure of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase [SOLUTION NMR]
Ensemble Structures of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase. [SOLUTION NMR]
NMR structure note: murine Itk SH3 domain [SOLUTION NMR]
>> 2 additional structures at PDB <<

Predicted Effect

probably damaging
Transcript: ENSMUST00000020664
AA Change: R533C

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000020664
Gene: ENSMUSG00000020395
AA Change: R533C

Domain	Start	End	E-Value	Type
PH	5	113	2.3e-13	SMART
BTK	113	149	1.1e-21	SMART
SH3	174	230	5.87e-14	SMART
SH2	237	328	9.44e-29	SMART
TyrKc	362	611	3.28e-133	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109237
AA Change: R539C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104860
Gene: ENSMUSG00000020395
AA Change: R539C

Domain	Start	End	E-Value	Type
PH	5	119	3.94e-12	SMART
BTK	119	155	1.1e-21	SMART
SH3	180	236	5.87e-14	SMART
SH2	243	334	9.44e-29	SMART
TyrKc	368	617	3.28e-133	SMART

Meta Mutation Damage Score

0.4989

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular tyrosine kinase expressed in T-cells. The protein contains both SH2 and SH3 domains which are often found in intracellular kinases. It is thought to play a role in T-cell proliferation and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display decreased percentages of CD4 and CD8 cells, increased percentage of B cells, impaired T cell receptor signaling, and increased susceptibility to Toxoplasma gondii infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700069L16Rik	A	T	5: 113,703,781	C92*	probably null	Het
A830018L16Rik	G	T	1: 11,545,267	E155*	probably null	Het
Acaa1a	A	T	9: 119,349,352		probably null	Het
Adcy4	T	C	14: 55,771,378	E864G	probably null	Het
Adcy4	T	C	14: 55,778,699	D387G	probably damaging	Het
Ank1	C	T	8: 23,098,939	H574Y	probably damaging	Het
Arhgef16	C	T	4: 154,287,038	E233K	probably damaging	Het
Arhgef26	A	T	3: 62,448,104	Y699F	probably benign	Het
BB014433	C	T	8: 15,042,101	V251M	probably damaging	Het
Bcan	G	A	3: 87,994,222	A391V	probably benign	Het
Bod1l	A	C	5: 41,816,867	V2368G	probably benign	Het
Braf	A	G	6: 39,662,151	V222A	probably damaging	Het
Cd33	G	T	7: 43,533,447		probably benign	Het
Cdkl2	T	A	5: 92,022,151	K324N	probably damaging	Het
Celf6	A	T	9: 59,602,871	T199S	probably damaging	Het
Cmtm4	A	C	8: 104,355,166	D196E	probably benign	Het
Cntn1	G	A	15: 92,234,466	V148M	probably damaging	Het
Col1a2	C	A	6: 4,535,451	P921H	unknown	Het
Crmp1	T	C	5: 37,242,146	M1T	probably null	Het
Dnah7a	A	T	1: 53,504,103	Y2303N	probably damaging	Het
Dock10	G	T	1: 80,574,171	T650K	probably benign	Het
Fam24a	A	G	7: 131,336,540	D53G	probably benign	Het
Foxa2	A	T	2: 148,044,706	M69K	probably benign	Het
Gatad2a	T	A	8: 69,909,935	H601L	probably damaging	Het
Gimap4	A	C	6: 48,690,605	D98A	probably damaging	Het
Gm14295	G	T	2: 176,809,830	R371L	possibly damaging	Het
Gm5039	A	G	12: 88,321,400	F28L	probably benign	Het
Golim4	G	T	3: 75,878,128	A652E	probably benign	Het
Grid1	A	G	14: 35,026,942	I240V	probably benign	Het
Iqsec3	T	A	6: 121,413,313	T400S	unknown	Het
Kdelc1	G	T	1: 44,112,764	L322I	possibly damaging	Het
Kif27	T	A	13: 58,326,098	D695V	possibly damaging	Het
Krt79	T	C	15: 101,931,006		probably benign	Het
Lama2	C	A	10: 27,422,714	V129L	possibly damaging	Het
Lonrf1	C	A	8: 36,229,238	E552D	possibly damaging	Het
Mpp3	A	G	11: 102,000,665	I549T	probably benign	Het
Nat1	T	C	8: 67,491,742	Y260H	probably benign	Het
Nipal2	T	A	15: 34,648,837	K69*	probably null	Het
Nlrx1	G	T	9: 44,256,941		probably benign	Het
Pde1b	C	A	15: 103,521,425	A115E	probably benign	Het
Pde4dip	A	G	3: 97,766,494	Y369H	probably damaging	Het
Pnpla7	A	G	2: 25,053,419	Y1286C	possibly damaging	Het
Pramel5	T	C	4: 144,272,959	E186G	possibly damaging	Het
Qdpr	C	T	5: 45,450,044	G20D	probably damaging	Het
Rmnd1	T	G	10: 4,407,918	I364L	probably benign	Het
Slc5a4a	A	T	10: 76,186,535	E568V	probably benign	Het
Slc6a18	T	A	13: 73,668,271	I330F	probably benign	Het
Spesp1	T	C	9: 62,273,270	T119A	possibly damaging	Het
Sypl	G	A	12: 32,975,663	S242N	probably benign	Het
Tbx18	G	A	9: 87,730,717	T43M	probably benign	Het
Tm7sf2	T	A	19: 6,063,926	D263V	probably damaging	Het
Trbv21	T	C	6: 41,202,990	I80T	probably damaging	Het
Ttc3	T	A	16: 94,427,808	L747Q	possibly damaging	Het
Ttll11	T	C	2: 35,817,801	D498G	possibly damaging	Het
Ttn	T	C	2: 76,753,370	Y22431C	probably null	Het
Ubtfl1	T	A	9: 18,410,341	S388R		Het
Vmn2r118	A	T	17: 55,610,835	L226I	possibly damaging	Het
Wdr46	A	G	17: 33,949,182	H576R	probably benign	Het
Zfp426	A	G	9: 20,475,000	F62L	probably damaging	Het

Other mutations in Itk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Itk	APN	11	46367896	missense	probably damaging	1.00
IGL01349:Itk	APN	11	46341200	missense	possibly damaging	0.84
IGL03290:Itk	APN	11	46334937	missense	probably damaging	1.00
IGL03385:Itk	APN	11	46331861	nonsense	probably null
Calame	UTSW	11	46342395	splice site	probably null
carbone	UTSW	11	46331949	nonsense	probably null
demon	UTSW	11	46340712	missense	probably damaging	1.00
goodnow	UTSW	11	46338099	splice site	probably null
itxaro	UTSW	11	46338217	missense	probably damaging	1.00
BB009:Itk	UTSW	11	46340692	missense	probably benign
BB019:Itk	UTSW	11	46340692	missense	probably benign
R0095:Itk	UTSW	11	46342452	missense	probably damaging	0.99
R0265:Itk	UTSW	11	46389458	start gained	probably benign
R0281:Itk	UTSW	11	46353916	missense	probably damaging	1.00
R0463:Itk	UTSW	11	46331989	missense	probably damaging	1.00
R0518:Itk	UTSW	11	46360288	missense	probably damaging	0.98
R0521:Itk	UTSW	11	46360288	missense	probably damaging	0.98
R1121:Itk	UTSW	11	46331894	missense	possibly damaging	0.93
R1550:Itk	UTSW	11	46389326	missense	probably damaging	1.00
R1762:Itk	UTSW	11	46336482	missense	probably damaging	0.98
R2418:Itk	UTSW	11	46338217	missense	probably damaging	1.00
R2419:Itk	UTSW	11	46338217	missense	probably damaging	1.00
R2859:Itk	UTSW	11	46344835	intron	probably benign
R3107:Itk	UTSW	11	46327464	missense	probably benign	0.15
R3546:Itk	UTSW	11	46355848	missense	probably benign	0.00
R4601:Itk	UTSW	11	46336515	missense	probably benign	0.17
R4610:Itk	UTSW	11	46336515	missense	probably benign	0.17
R4792:Itk	UTSW	11	46344831	intron	probably benign
R4885:Itk	UTSW	11	46336344	splice site	probably null
R4934:Itk	UTSW	11	46389325	missense	probably damaging	1.00
R5286:Itk	UTSW	11	46338099	splice site	probably null
R5328:Itk	UTSW	11	46331876	missense	probably benign	0.04
R5399:Itk	UTSW	11	46338111	missense	probably benign	0.44
R5958:Itk	UTSW	11	46344855	intron	probably benign
R6235:Itk	UTSW	11	46336428	missense	probably benign	0.16
R6828:Itk	UTSW	11	46341218	missense	probably damaging	1.00
R6849:Itk	UTSW	11	46331935	missense	probably damaging	1.00
R7356:Itk	UTSW	11	46367832	missense	possibly damaging	0.72
R7753:Itk	UTSW	11	46331895	missense	probably damaging	1.00
R7932:Itk	UTSW	11	46340692	missense	probably benign
R7988:Itk	UTSW	11	46355834	missense	probably damaging	0.99
R8188:Itk	UTSW	11	46331949	nonsense	probably null
R8337:Itk	UTSW	11	46342395	splice site	probably null
R8738:Itk	UTSW	11	46340712	missense	probably damaging	1.00
U24488:Itk	UTSW	11	46338144	missense	probably damaging	1.00
X0062:Itk	UTSW	11	46366044	missense	probably benign	0.15
Z1088:Itk	UTSW	11	46353862	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- AAAGAGCCCGCTTGAACATC -3'
(R):5'- ACCAGGTCATCAAGGTGTCC -3'

Sequencing Primer
(F):5'- CGCTTGAACATCTCAGGTTG -3'
(R):5'- TCCGACTTTGGGATGACAAG -3'

Posted On

2021-10-11