Incidental Mutation 'R8993:Itk'
ID 684558
Institutional Source Beutler Lab
Gene Symbol Itk
Ensembl Gene ENSMUSG00000020395
Gene Name IL2 inducible T cell kinase
Synonyms Emt, Tsk, Tcsk
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock # R8993 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 46325150-46389515 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 46334908 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 539 (R539C)
Ref Sequence ENSEMBL: ENSMUSP00000104860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020664] [ENSMUST00000109237]
AlphaFold Q03526
PDB Structure INTRAMOLECULAR ITK-PROLINE COMPLEX, NMR, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
NMR Structures of Itk SH2 domain, Pro287cis isoform, ensemble of 20 low energy structures [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287cis, Energy minimized average structure [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287trans, 20 low energy structures [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287trans, energy minimized average structure [SOLUTION NMR]
The NMR minimized average structure of the Itk SH2 domain bound to a phosphopeptide [SOLUTION NMR]
The NMR ensemble structure of the Itk SH2 domain bound to a phosphopeptide [SOLUTION NMR]
Solution Structure of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase [SOLUTION NMR]
Ensemble Structures of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase. [SOLUTION NMR]
NMR structure note: murine Itk SH3 domain [SOLUTION NMR]
>> 2 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000020664
AA Change: R533C

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020664
Gene: ENSMUSG00000020395
AA Change: R533C

DomainStartEndE-ValueType
PH 5 113 2.3e-13 SMART
BTK 113 149 1.1e-21 SMART
SH3 174 230 5.87e-14 SMART
SH2 237 328 9.44e-29 SMART
TyrKc 362 611 3.28e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109237
AA Change: R539C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104860
Gene: ENSMUSG00000020395
AA Change: R539C

DomainStartEndE-ValueType
PH 5 119 3.94e-12 SMART
BTK 119 155 1.1e-21 SMART
SH3 180 236 5.87e-14 SMART
SH2 243 334 9.44e-29 SMART
TyrKc 368 617 3.28e-133 SMART
Meta Mutation Damage Score 0.4989 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular tyrosine kinase expressed in T-cells. The protein contains both SH2 and SH3 domains which are often found in intracellular kinases. It is thought to play a role in T-cell proliferation and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display decreased percentages of CD4 and CD8 cells, increased percentage of B cells, impaired T cell receptor signaling, and increased susceptibility to Toxoplasma gondii infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A T 5: 113,703,781 C92* probably null Het
A830018L16Rik G T 1: 11,545,267 E155* probably null Het
Acaa1a A T 9: 119,349,352 probably null Het
Adcy4 T C 14: 55,771,378 E864G probably null Het
Adcy4 T C 14: 55,778,699 D387G probably damaging Het
Ank1 C T 8: 23,098,939 H574Y probably damaging Het
Arhgef16 C T 4: 154,287,038 E233K probably damaging Het
Arhgef26 A T 3: 62,448,104 Y699F probably benign Het
BB014433 C T 8: 15,042,101 V251M probably damaging Het
Bcan G A 3: 87,994,222 A391V probably benign Het
Bod1l A C 5: 41,816,867 V2368G probably benign Het
Braf A G 6: 39,662,151 V222A probably damaging Het
Cd33 G T 7: 43,533,447 probably benign Het
Cdkl2 T A 5: 92,022,151 K324N probably damaging Het
Celf6 A T 9: 59,602,871 T199S probably damaging Het
Cmtm4 A C 8: 104,355,166 D196E probably benign Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Col1a2 C A 6: 4,535,451 P921H unknown Het
Crmp1 T C 5: 37,242,146 M1T probably null Het
Dnah7a A T 1: 53,504,103 Y2303N probably damaging Het
Dock10 G T 1: 80,574,171 T650K probably benign Het
Fam24a A G 7: 131,336,540 D53G probably benign Het
Foxa2 A T 2: 148,044,706 M69K probably benign Het
Gatad2a T A 8: 69,909,935 H601L probably damaging Het
Gimap4 A C 6: 48,690,605 D98A probably damaging Het
Gm14295 G T 2: 176,809,830 R371L possibly damaging Het
Gm5039 A G 12: 88,321,400 F28L probably benign Het
Golim4 G T 3: 75,878,128 A652E probably benign Het
Grid1 A G 14: 35,026,942 I240V probably benign Het
Iqsec3 T A 6: 121,413,313 T400S unknown Het
Kdelc1 G T 1: 44,112,764 L322I possibly damaging Het
Kif27 T A 13: 58,326,098 D695V possibly damaging Het
Krt79 T C 15: 101,931,006 probably benign Het
Lama2 C A 10: 27,422,714 V129L possibly damaging Het
Lonrf1 C A 8: 36,229,238 E552D possibly damaging Het
Mpp3 A G 11: 102,000,665 I549T probably benign Het
Nat1 T C 8: 67,491,742 Y260H probably benign Het
Nipal2 T A 15: 34,648,837 K69* probably null Het
Nlrx1 G T 9: 44,256,941 probably benign Het
Pde1b C A 15: 103,521,425 A115E probably benign Het
Pde4dip A G 3: 97,766,494 Y369H probably damaging Het
Pnpla7 A G 2: 25,053,419 Y1286C possibly damaging Het
Pramel5 T C 4: 144,272,959 E186G possibly damaging Het
Qdpr C T 5: 45,450,044 G20D probably damaging Het
Rmnd1 T G 10: 4,407,918 I364L probably benign Het
Slc5a4a A T 10: 76,186,535 E568V probably benign Het
Slc6a18 T A 13: 73,668,271 I330F probably benign Het
Spesp1 T C 9: 62,273,270 T119A possibly damaging Het
Sypl G A 12: 32,975,663 S242N probably benign Het
Tbx18 G A 9: 87,730,717 T43M probably benign Het
Tm7sf2 T A 19: 6,063,926 D263V probably damaging Het
Trbv21 T C 6: 41,202,990 I80T probably damaging Het
Ttc3 T A 16: 94,427,808 L747Q possibly damaging Het
Ttll11 T C 2: 35,817,801 D498G possibly damaging Het
Ttn T C 2: 76,753,370 Y22431C probably null Het
Ubtfl1 T A 9: 18,410,341 S388R Het
Vmn2r118 A T 17: 55,610,835 L226I possibly damaging Het
Wdr46 A G 17: 33,949,182 H576R probably benign Het
Zfp426 A G 9: 20,475,000 F62L probably damaging Het
Other mutations in Itk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Itk APN 11 46367896 missense probably damaging 1.00
IGL01349:Itk APN 11 46341200 missense possibly damaging 0.84
IGL03290:Itk APN 11 46334937 missense probably damaging 1.00
IGL03385:Itk APN 11 46331861 nonsense probably null
Calame UTSW 11 46342395 splice site probably null
carbone UTSW 11 46331949 nonsense probably null
demon UTSW 11 46340712 missense probably damaging 1.00
goodnow UTSW 11 46338099 splice site probably null
itxaro UTSW 11 46338217 missense probably damaging 1.00
BB009:Itk UTSW 11 46340692 missense probably benign
BB019:Itk UTSW 11 46340692 missense probably benign
R0095:Itk UTSW 11 46342452 missense probably damaging 0.99
R0265:Itk UTSW 11 46389458 start gained probably benign
R0281:Itk UTSW 11 46353916 missense probably damaging 1.00
R0463:Itk UTSW 11 46331989 missense probably damaging 1.00
R0518:Itk UTSW 11 46360288 missense probably damaging 0.98
R0521:Itk UTSW 11 46360288 missense probably damaging 0.98
R1121:Itk UTSW 11 46331894 missense possibly damaging 0.93
R1550:Itk UTSW 11 46389326 missense probably damaging 1.00
R1762:Itk UTSW 11 46336482 missense probably damaging 0.98
R2418:Itk UTSW 11 46338217 missense probably damaging 1.00
R2419:Itk UTSW 11 46338217 missense probably damaging 1.00
R2859:Itk UTSW 11 46344835 intron probably benign
R3107:Itk UTSW 11 46327464 missense probably benign 0.15
R3546:Itk UTSW 11 46355848 missense probably benign 0.00
R4601:Itk UTSW 11 46336515 missense probably benign 0.17
R4610:Itk UTSW 11 46336515 missense probably benign 0.17
R4792:Itk UTSW 11 46344831 intron probably benign
R4885:Itk UTSW 11 46336344 splice site probably null
R4934:Itk UTSW 11 46389325 missense probably damaging 1.00
R5286:Itk UTSW 11 46338099 splice site probably null
R5328:Itk UTSW 11 46331876 missense probably benign 0.04
R5399:Itk UTSW 11 46338111 missense probably benign 0.44
R5958:Itk UTSW 11 46344855 intron probably benign
R6235:Itk UTSW 11 46336428 missense probably benign 0.16
R6828:Itk UTSW 11 46341218 missense probably damaging 1.00
R6849:Itk UTSW 11 46331935 missense probably damaging 1.00
R7356:Itk UTSW 11 46367832 missense possibly damaging 0.72
R7753:Itk UTSW 11 46331895 missense probably damaging 1.00
R7932:Itk UTSW 11 46340692 missense probably benign
R7988:Itk UTSW 11 46355834 missense probably damaging 0.99
R8188:Itk UTSW 11 46331949 nonsense probably null
R8337:Itk UTSW 11 46342395 splice site probably null
R8738:Itk UTSW 11 46340712 missense probably damaging 1.00
U24488:Itk UTSW 11 46338144 missense probably damaging 1.00
X0062:Itk UTSW 11 46366044 missense probably benign 0.15
Z1088:Itk UTSW 11 46353862 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAAGAGCCCGCTTGAACATC -3'
(R):5'- ACCAGGTCATCAAGGTGTCC -3'

Sequencing Primer
(F):5'- CGCTTGAACATCTCAGGTTG -3'
(R):5'- TCCGACTTTGGGATGACAAG -3'
Posted On 2021-10-11