Incidental Mutation 'R8993:Mpp3'
ID 684559
Institutional Source Beutler Lab
Gene Symbol Mpp3
Ensembl Gene ENSMUSG00000052373
Gene Name membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
Synonyms Dlgh3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8993 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 101999652-102028461 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102000665 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 549 (I549T)
Ref Sequence ENSEMBL: ENSMUSP00000055469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062801] [ENSMUST00000100400] [ENSMUST00000107168]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000062801
AA Change: I549T

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000055469
Gene: ENSMUSG00000052373
AA Change: I549T

DomainStartEndE-ValueType
L27 10 64 1.5e-8 SMART
L27 68 121 1.18e-15 SMART
PDZ 145 218 1.06e-13 SMART
SH3 229 295 7.7e-9 SMART
GuKc 384 573 1.76e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100400
AA Change: I549T

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000097969
Gene: ENSMUSG00000052373
AA Change: I549T

DomainStartEndE-ValueType
L27 10 64 1.5e-8 SMART
L27 68 121 1.18e-15 SMART
PDZ 145 218 1.06e-13 SMART
SH3 229 295 7.7e-9 SMART
GuKc 384 573 1.76e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107168
AA Change: I549T

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000102786
Gene: ENSMUSG00000052373
AA Change: I549T

DomainStartEndE-ValueType
L27 10 64 1.5e-8 SMART
L27 68 121 1.18e-15 SMART
PDZ 145 218 1.06e-13 SMART
SH3 229 295 7.7e-9 SMART
GuKc 384 573 1.76e-70 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of a family of membrane-associated proteins termed MAGUKs (membrane-associated guanylate kinase homologs). MAGUKs interact with the cytoskeleton and regulate cell proliferation, signaling pathways, and intracellular junctions. This protein contains a conserved sequence, called the SH3 (src homology 3) motif, found in several other proteins that associate with the cytoskeleton and are suspected to play important roles in signal transduction. Alternatively spliced transcript variants have been identified. One transcript variant is experimentally supported, but it doesn't encode a protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A T 5: 113,703,781 C92* probably null Het
A830018L16Rik G T 1: 11,545,267 E155* probably null Het
Acaa1a A T 9: 119,349,352 probably null Het
Adcy4 T C 14: 55,771,378 E864G probably null Het
Adcy4 T C 14: 55,778,699 D387G probably damaging Het
Ank1 C T 8: 23,098,939 H574Y probably damaging Het
Arhgef16 C T 4: 154,287,038 E233K probably damaging Het
Arhgef26 A T 3: 62,448,104 Y699F probably benign Het
BB014433 C T 8: 15,042,101 V251M probably damaging Het
Bcan G A 3: 87,994,222 A391V probably benign Het
Bod1l A C 5: 41,816,867 V2368G probably benign Het
Braf A G 6: 39,662,151 V222A probably damaging Het
Cd33 G T 7: 43,533,447 probably benign Het
Cdkl2 T A 5: 92,022,151 K324N probably damaging Het
Celf6 A T 9: 59,602,871 T199S probably damaging Het
Cmtm4 A C 8: 104,355,166 D196E probably benign Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Col1a2 C A 6: 4,535,451 P921H unknown Het
Crmp1 T C 5: 37,242,146 M1T probably null Het
Dnah7a A T 1: 53,504,103 Y2303N probably damaging Het
Dock10 G T 1: 80,574,171 T650K probably benign Het
Fam24a A G 7: 131,336,540 D53G probably benign Het
Foxa2 A T 2: 148,044,706 M69K probably benign Het
Gatad2a T A 8: 69,909,935 H601L probably damaging Het
Gimap4 A C 6: 48,690,605 D98A probably damaging Het
Gm14295 G T 2: 176,809,830 R371L possibly damaging Het
Gm5039 A G 12: 88,321,400 F28L probably benign Het
Golim4 G T 3: 75,878,128 A652E probably benign Het
Grid1 A G 14: 35,026,942 I240V probably benign Het
Iqsec3 T A 6: 121,413,313 T400S unknown Het
Itk G A 11: 46,334,908 R539C probably damaging Het
Kdelc1 G T 1: 44,112,764 L322I possibly damaging Het
Kif27 T A 13: 58,326,098 D695V possibly damaging Het
Krt79 T C 15: 101,931,006 probably benign Het
Lama2 C A 10: 27,422,714 V129L possibly damaging Het
Lonrf1 C A 8: 36,229,238 E552D possibly damaging Het
Nat1 T C 8: 67,491,742 Y260H probably benign Het
Nipal2 T A 15: 34,648,837 K69* probably null Het
Nlrx1 G T 9: 44,256,941 probably benign Het
Pde1b C A 15: 103,521,425 A115E probably benign Het
Pde4dip A G 3: 97,766,494 Y369H probably damaging Het
Pnpla7 A G 2: 25,053,419 Y1286C possibly damaging Het
Pramel5 T C 4: 144,272,959 E186G possibly damaging Het
Qdpr C T 5: 45,450,044 G20D probably damaging Het
Rmnd1 T G 10: 4,407,918 I364L probably benign Het
Slc5a4a A T 10: 76,186,535 E568V probably benign Het
Slc6a18 T A 13: 73,668,271 I330F probably benign Het
Spesp1 T C 9: 62,273,270 T119A possibly damaging Het
Sypl G A 12: 32,975,663 S242N probably benign Het
Tbx18 G A 9: 87,730,717 T43M probably benign Het
Tm7sf2 T A 19: 6,063,926 D263V probably damaging Het
Trbv21 T C 6: 41,202,990 I80T probably damaging Het
Ttc3 T A 16: 94,427,808 L747Q possibly damaging Het
Ttll11 T C 2: 35,817,801 D498G possibly damaging Het
Ttn T C 2: 76,753,370 Y22431C probably null Het
Ubtfl1 T A 9: 18,410,341 S388R Het
Vmn2r118 A T 17: 55,610,835 L226I possibly damaging Het
Wdr46 A G 17: 33,949,182 H576R probably benign Het
Zfp426 A G 9: 20,475,000 F62L probably damaging Het
Other mutations in Mpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Mpp3 APN 11 102002103 missense possibly damaging 0.76
IGL01337:Mpp3 APN 11 102000585 missense probably benign
IGL01393:Mpp3 APN 11 102025478 missense probably damaging 0.99
IGL01544:Mpp3 APN 11 102018659 missense possibly damaging 0.91
IGL02152:Mpp3 APN 11 102025390 nonsense probably null
IGL02441:Mpp3 APN 11 102009675 missense probably benign 0.00
IGL02656:Mpp3 APN 11 102008601 missense probably benign
R0013:Mpp3 UTSW 11 102005425 missense probably benign 0.27
R0117:Mpp3 UTSW 11 102000573 missense probably damaging 1.00
R0564:Mpp3 UTSW 11 102005347 missense possibly damaging 0.87
R1372:Mpp3 UTSW 11 102000575 missense probably damaging 0.96
R1531:Mpp3 UTSW 11 102008649 missense probably benign
R1639:Mpp3 UTSW 11 102023442 missense probably damaging 1.00
R1720:Mpp3 UTSW 11 102025756 start codon destroyed possibly damaging 0.79
R1968:Mpp3 UTSW 11 102018552 intron probably benign
R2064:Mpp3 UTSW 11 102000690 missense probably benign 0.01
R2363:Mpp3 UTSW 11 102020486 missense probably damaging 1.00
R3775:Mpp3 UTSW 11 102023367 nonsense probably null
R3776:Mpp3 UTSW 11 102023367 nonsense probably null
R4208:Mpp3 UTSW 11 102000600 missense probably benign
R4287:Mpp3 UTSW 11 102023463 missense probably damaging 1.00
R4327:Mpp3 UTSW 11 102023511 intron probably benign
R4329:Mpp3 UTSW 11 102023511 intron probably benign
R4367:Mpp3 UTSW 11 102023420 missense probably benign 0.01
R4856:Mpp3 UTSW 11 102025136 missense probably benign
R4886:Mpp3 UTSW 11 102025136 missense probably benign
R4904:Mpp3 UTSW 11 102000587 missense probably benign 0.01
R4946:Mpp3 UTSW 11 102005022 missense probably benign 0.01
R5405:Mpp3 UTSW 11 102010221 missense probably benign
R5935:Mpp3 UTSW 11 102025415 missense probably damaging 1.00
R6020:Mpp3 UTSW 11 102018539 intron probably benign
R6056:Mpp3 UTSW 11 102011689 splice site probably null
R6151:Mpp3 UTSW 11 102008566 missense probably benign 0.11
R6677:Mpp3 UTSW 11 102008618 missense probably benign
R6784:Mpp3 UTSW 11 102002148 critical splice acceptor site probably null
R6855:Mpp3 UTSW 11 102013325 missense probably benign 0.09
R7227:Mpp3 UTSW 11 102005078 missense possibly damaging 0.90
R7635:Mpp3 UTSW 11 102025383 missense probably damaging 0.97
R7974:Mpp3 UTSW 11 102008354 critical splice donor site probably null
R8330:Mpp3 UTSW 11 102008627 missense probably benign 0.20
R8331:Mpp3 UTSW 11 102011715 splice site probably null
R9154:Mpp3 UTSW 11 102020502 missense
Z1176:Mpp3 UTSW 11 102008356 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAACACTGAGCAAGGCTTCC -3'
(R):5'- CGTGTTCACAGTTAAGGTAATCC -3'

Sequencing Primer
(F):5'- CTGCACTTGAGATTCCTTGATGGTAC -3'
(R):5'- TCACAGTTAAGGTAATCCATGGGAC -3'
Posted On 2021-10-11