Mutagenetix > Incidental Mutations

Incidental Mutation 'R8993:Kif27'

684562

Institutional Source

Beutler Lab

Gene Symbol

Kif27

Ensembl Gene

ENSMUSG00000060176

Gene Name

kinesin family member 27

Synonyms

4930517I18Rik

Accession Numbers

NCBI RefSeq: NM_175214.3; MGI:1922300

Is this an essential gene?

Probably non essential (E-score: 0.135) question?

Stock #

R8993 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58287502-58359122 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 58326098 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 695 (D695V)

Ref Sequence

ENSEMBL: ENSMUSP00000043304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043605] [ENSMUST00000224694] [ENSMUST00000225388]

AlphaFold

Q7M6Z4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043605
AA Change: D695V

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000043304
Gene: ENSMUSG00000060176
AA Change: D695V

Domain	Start	End	E-Value	Type
KISc	3	349	9.18e-160	SMART
low complexity region	369	385	N/A	INTRINSIC
coiled coil region	386	418	N/A	INTRINSIC
Blast:KISc	486	566	5e-29	BLAST
coiled coil region	710	790	N/A	INTRINSIC
coiled coil region	835	891	N/A	INTRINSIC
coiled coil region	916	972	N/A	INTRINSIC
low complexity region	993	1008	N/A	INTRINSIC
coiled coil region	1010	1078	N/A	INTRINSIC
coiled coil region	1186	1226	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000224694

Predicted Effect

possibly damaging
Transcript: ENSMUST00000225388
AA Change: D695V

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (56/56)

MGI Phenotype

Strain: 4318693
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the KIF27 (kinesin 4) sub-family of the mammalian kinesin family. The gene is an ortholog of the Drosophila Cos2 gene, which plays an important role in the Hedgehog signaling pathway. The encoded protein contains an N-terminal motor domain which includes nucleotide-binding and microtubule-interacting regions, a stalk domain containing a predicted coiled coil motif and a C-terminal tail domain. Alternatively spliced transcript variants have been observed for this gene. Pseudogenes associated with this gene are located on chromosome 9. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous mice are small and die by 8 weeks and exhibit hydrocephalus, rhinitis and otitis media. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted(2) Gene trapped(7)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700069L16Rik	A	T	5: 113,703,781	C92*	probably null	Het
A830018L16Rik	G	T	1: 11,545,267	E155*	probably null	Het
Acaa1a	A	T	9: 119,349,352		probably null	Het
Adcy4	T	C	14: 55,771,378	E864G	probably null	Het
Adcy4	T	C	14: 55,778,699	D387G	probably damaging	Het
Ank1	C	T	8: 23,098,939	H574Y	probably damaging	Het
Arhgef16	C	T	4: 154,287,038	E233K	probably damaging	Het
Arhgef26	A	T	3: 62,448,104	Y699F	probably benign	Het
BB014433	C	T	8: 15,042,101	V251M	probably damaging	Het
Bcan	G	A	3: 87,994,222	A391V	probably benign	Het
Bod1l	A	C	5: 41,816,867	V2368G	probably benign	Het
Braf	A	G	6: 39,662,151	V222A	probably damaging	Het
Cd33	G	T	7: 43,533,447		probably benign	Het
Cdkl2	T	A	5: 92,022,151	K324N	probably damaging	Het
Celf6	A	T	9: 59,602,871	T199S	probably damaging	Het
Cmtm4	A	C	8: 104,355,166	D196E	probably benign	Het
Cntn1	G	A	15: 92,234,466	V148M	probably damaging	Het
Col1a2	C	A	6: 4,535,451	P921H	unknown	Het
Crmp1	T	C	5: 37,242,146	M1T	probably null	Het
Dnah7a	A	T	1: 53,504,103	Y2303N	probably damaging	Het
Dock10	G	T	1: 80,574,171	T650K	probably benign	Het
Fam24a	A	G	7: 131,336,540	D53G	probably benign	Het
Foxa2	A	T	2: 148,044,706	M69K	probably benign	Het
Gatad2a	T	A	8: 69,909,935	H601L	probably damaging	Het
Gimap4	A	C	6: 48,690,605	D98A	probably damaging	Het
Gm14295	G	T	2: 176,809,830	R371L	possibly damaging	Het
Gm5039	A	G	12: 88,321,400	F28L	probably benign	Het
Golim4	G	T	3: 75,878,128	A652E	probably benign	Het
Grid1	A	G	14: 35,026,942	I240V	probably benign	Het
Iqsec3	T	A	6: 121,413,313	T400S	unknown	Het
Itk	G	A	11: 46,334,908	R539C	probably damaging	Het
Kdelc1	G	T	1: 44,112,764	L322I	possibly damaging	Het
Krt79	T	C	15: 101,931,006		probably benign	Het
Lama2	C	A	10: 27,422,714	V129L	possibly damaging	Het
Lonrf1	C	A	8: 36,229,238	E552D	possibly damaging	Het
Mpp3	A	G	11: 102,000,665	I549T	probably benign	Het
Nat1	T	C	8: 67,491,742	Y260H	probably benign	Het
Nipal2	T	A	15: 34,648,837	K69*	probably null	Het
Nlrx1	G	T	9: 44,256,941		probably benign	Het
Pde1b	C	A	15: 103,521,425	A115E	probably benign	Het
Pde4dip	A	G	3: 97,766,494	Y369H	probably damaging	Het
Pnpla7	A	G	2: 25,053,419	Y1286C	possibly damaging	Het
Pramel5	T	C	4: 144,272,959	E186G	possibly damaging	Het
Qdpr	C	T	5: 45,450,044	G20D	probably damaging	Het
Rmnd1	T	G	10: 4,407,918	I364L	probably benign	Het
Slc5a4a	A	T	10: 76,186,535	E568V	probably benign	Het
Slc6a18	T	A	13: 73,668,271	I330F	probably benign	Het
Spesp1	T	C	9: 62,273,270	T119A	possibly damaging	Het
Sypl	G	A	12: 32,975,663	S242N	probably benign	Het
Tbx18	G	A	9: 87,730,717	T43M	probably benign	Het
Tm7sf2	T	A	19: 6,063,926	D263V	probably damaging	Het
Trbv21	T	C	6: 41,202,990	I80T	probably damaging	Het
Ttc3	T	A	16: 94,427,808	L747Q	possibly damaging	Het
Ttll11	T	C	2: 35,817,801	D498G	possibly damaging	Het
Ttn	T	C	2: 76,753,370	Y22431C	probably null	Het
Ubtfl1	T	A	9: 18,410,341	S388R		Het
Vmn2r118	A	T	17: 55,610,835	L226I	possibly damaging	Het
Wdr46	A	G	17: 33,949,182	H576R	probably benign	Het
Zfp426	A	G	9: 20,475,000	F62L	probably damaging	Het

Other mutations in Kif27

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Kif27	APN	13	58337604	missense	probably benign
IGL00421:Kif27	APN	13	58343889	missense	probably damaging	1.00
IGL00903:Kif27	APN	13	58344672	missense	possibly damaging	0.69
IGL01024:Kif27	APN	13	58288201	missense	possibly damaging	0.71
IGL01070:Kif27	APN	13	58344093	missense	probably damaging	1.00
IGL01761:Kif27	APN	13	58337645	missense	probably benign
IGL02160:Kif27	APN	13	58325998	missense	probably damaging	1.00
IGL03162:Kif27	APN	13	58311207	missense	probably benign	0.03
P0016:Kif27	UTSW	13	58303452	nonsense	probably null
R0016:Kif27	UTSW	13	58354714	missense	probably damaging	1.00
R0016:Kif27	UTSW	13	58354714	missense	probably damaging	1.00
R0018:Kif27	UTSW	13	58288053	missense	probably benign
R0018:Kif27	UTSW	13	58288053	missense	probably benign
R0049:Kif27	UTSW	13	58303564	missense	probably damaging	1.00
R0049:Kif27	UTSW	13	58303564	missense	probably damaging	1.00
R0481:Kif27	UTSW	13	58311264	splice site	probably benign
R0960:Kif27	UTSW	13	58323967	missense	probably damaging	0.99
R1015:Kif27	UTSW	13	58320215	missense	probably damaging	1.00
R1205:Kif27	UTSW	13	58344205	missense	probably benign	0.00
R1478:Kif27	UTSW	13	58303545	missense	probably damaging	0.98
R1789:Kif27	UTSW	13	58344008	missense	probably damaging	1.00
R1959:Kif27	UTSW	13	58293123	missense	probably benign	0.00
R1961:Kif27	UTSW	13	58293123	missense	probably benign	0.00
R3508:Kif27	UTSW	13	58313212	missense	possibly damaging	0.88
R4168:Kif27	UTSW	13	58345748	missense	probably benign	0.01
R4247:Kif27	UTSW	13	58287917	missense	probably damaging	0.98
R4307:Kif27	UTSW	13	58344123	missense	probably benign	0.00
R4621:Kif27	UTSW	13	58331013	missense	probably benign	0.13
R4660:Kif27	UTSW	13	58323916	missense	probably damaging	0.99
R4661:Kif27	UTSW	13	58323916	missense	probably damaging	0.99
R4736:Kif27	UTSW	13	58328971	missense	probably benign	0.04
R4770:Kif27	UTSW	13	58344377	missense	probably damaging	1.00
R4853:Kif27	UTSW	13	58311258	missense	probably benign	0.06
R4963:Kif27	UTSW	13	58328994	missense	possibly damaging	0.85
R4998:Kif27	UTSW	13	58293143	missense	probably damaging	0.98
R5134:Kif27	UTSW	13	58291090	missense	possibly damaging	0.80
R5225:Kif27	UTSW	13	58293101	missense	possibly damaging	0.88
R5835:Kif27	UTSW	13	58313146	critical splice donor site	probably null
R5875:Kif27	UTSW	13	58311104	missense	probably benign	0.01
R5929:Kif27	UTSW	13	58343970	missense	probably benign	0.01
R6175:Kif27	UTSW	13	58311237	missense	probably damaging	1.00
R6446:Kif27	UTSW	13	58345716	missense	probably damaging	1.00
R6628:Kif27	UTSW	13	58354797	missense	probably damaging	1.00
R7480:Kif27	UTSW	13	58288211	missense	probably benign	0.34
R8381:Kif27	UTSW	13	58291177	missense	probably benign	0.00
R8815:Kif27	UTSW	13	58329004	missense	probably damaging	0.97
R9181:Kif27	UTSW	13	58344729	missense	probably damaging	1.00
Z1088:Kif27	UTSW	13	58288033	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACAAGGACAAGATGCTGTTACC -3'
(R):5'- TCAATTGCCACACATGCTCC -3'

Sequencing Primer
(F):5'- AGATCTTCTTTCATCCTGATGT -3'
(R):5'- AACCCTTTGAAGCTGTGAGC -3'

Posted On

2021-10-11