Incidental Mutation 'R8993:Adcy4'
ID 684566
Institutional Source Beutler Lab
Gene Symbol Adcy4
Ensembl Gene ENSMUSG00000022220
Gene Name adenylate cyclase 4
Synonyms
MMRRC Submission 068824-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8993 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 56006514-56021552 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 56016156 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 387 (D387G)
Ref Sequence ENSEMBL: ENSMUSP00000002398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002398] [ENSMUST00000170223] [ENSMUST00000227031]
AlphaFold Q91WF3
Predicted Effect probably damaging
Transcript: ENSMUST00000002398
AA Change: D387G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002398
Gene: ENSMUSG00000022220
AA Change: D387G

DomainStartEndE-ValueType
low complexity region 28 48 N/A INTRINSIC
low complexity region 66 80 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
CYCc 218 426 1.56e-62 SMART
Pfam:DUF1053 479 581 2.4e-35 PFAM
transmembrane domain 607 629 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 746 768 N/A INTRINSIC
transmembrane domain 792 809 N/A INTRINSIC
CYCc 835 1057 4.46e-40 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170223
AA Change: D387G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130530
Gene: ENSMUSG00000022220
AA Change: D387G

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 61 80 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 119 138 N/A INTRINSIC
transmembrane domain 145 162 N/A INTRINSIC
transmembrane domain 172 194 N/A INTRINSIC
CYCc 218 426 1.56e-62 SMART
Pfam:DUF1053 479 581 1.6e-24 PFAM
transmembrane domain 607 629 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 746 768 N/A INTRINSIC
transmembrane domain 792 809 N/A INTRINSIC
CYCc 835 1057 4.46e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227031
Meta Mutation Damage Score 0.9677 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of adenylate cyclases, which are membrane-associated enzymes that catalyze the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). Mouse studies show that adenylate cyclase 4, along with adenylate cyclases 2 and 3, is expressed in olfactory cilia, suggesting that several different adenylate cyclases may couple to olfactory receptors and that there may be multiple receptor-mediated mechanisms for the generation of cAMP signals. Alternative splicing results in transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for disruptions of this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A T 5: 113,841,842 (GRCm39) C92* probably null Het
A830018L16Rik G T 1: 11,615,491 (GRCm39) E155* probably null Het
Acaa1a A T 9: 119,178,418 (GRCm39) probably null Het
Ank1 C T 8: 23,588,955 (GRCm39) H574Y probably damaging Het
Arhgef16 C T 4: 154,371,495 (GRCm39) E233K probably damaging Het
Arhgef26 A T 3: 62,355,525 (GRCm39) Y699F probably benign Het
BB014433 C T 8: 15,092,101 (GRCm39) V251M probably damaging Het
Bcan G A 3: 87,901,529 (GRCm39) A391V probably benign Het
Bod1l A C 5: 41,974,210 (GRCm39) V2368G probably benign Het
Braf A G 6: 39,639,085 (GRCm39) V222A probably damaging Het
Cd33 G T 7: 43,182,871 (GRCm39) probably benign Het
Cdkl2 T A 5: 92,170,010 (GRCm39) K324N probably damaging Het
Celf6 A T 9: 59,510,154 (GRCm39) T199S probably damaging Het
Cmtm4 A C 8: 105,081,798 (GRCm39) D196E probably benign Het
Cntn1 G A 15: 92,132,347 (GRCm39) V148M probably damaging Het
Col1a2 C A 6: 4,535,451 (GRCm39) P921H unknown Het
Crmp1 T C 5: 37,399,490 (GRCm39) M1T probably null Het
Dnah7a A T 1: 53,543,262 (GRCm39) Y2303N probably damaging Het
Dock10 G T 1: 80,551,888 (GRCm39) T650K probably benign Het
Eif1ad15 A G 12: 88,288,170 (GRCm39) F28L probably benign Het
Fam24a A G 7: 130,938,269 (GRCm39) D53G probably benign Het
Foxa2 A T 2: 147,886,626 (GRCm39) M69K probably benign Het
Gatad2a T A 8: 70,362,585 (GRCm39) H601L probably damaging Het
Gimap4 A C 6: 48,667,539 (GRCm39) D98A probably damaging Het
Gm14295 G T 2: 176,501,623 (GRCm39) R371L possibly damaging Het
Golim4 G T 3: 75,785,435 (GRCm39) A652E probably benign Het
Grid1 A G 14: 34,748,899 (GRCm39) I240V probably benign Het
Iqsec3 T A 6: 121,390,272 (GRCm39) T400S unknown Het
Itk G A 11: 46,225,735 (GRCm39) R539C probably damaging Het
Kif27 T A 13: 58,473,912 (GRCm39) D695V possibly damaging Het
Krt79 T C 15: 101,839,441 (GRCm39) probably benign Het
Lama2 C A 10: 27,298,710 (GRCm39) V129L possibly damaging Het
Lonrf1 C A 8: 36,696,392 (GRCm39) E552D possibly damaging Het
Mpp3 A G 11: 101,891,491 (GRCm39) I549T probably benign Het
Nat1 T C 8: 67,944,394 (GRCm39) Y260H probably benign Het
Nipal2 T A 15: 34,648,983 (GRCm39) K69* probably null Het
Nlrx1 G T 9: 44,168,238 (GRCm39) probably benign Het
Pde1b C A 15: 103,429,852 (GRCm39) A115E probably benign Het
Pde4dip A G 3: 97,673,810 (GRCm39) Y369H probably damaging Het
Pnpla7 A G 2: 24,943,431 (GRCm39) Y1286C possibly damaging Het
Poglut2 G T 1: 44,151,924 (GRCm39) L322I possibly damaging Het
Pramel5 T C 4: 143,999,529 (GRCm39) E186G possibly damaging Het
Qdpr C T 5: 45,607,386 (GRCm39) G20D probably damaging Het
Rmnd1 T G 10: 4,357,918 (GRCm39) I364L probably benign Het
Slc5a4a A T 10: 76,022,369 (GRCm39) E568V probably benign Het
Slc6a18 T A 13: 73,816,390 (GRCm39) I330F probably benign Het
Spesp1 T C 9: 62,180,552 (GRCm39) T119A possibly damaging Het
Sypl1 G A 12: 33,025,662 (GRCm39) S242N probably benign Het
Tbx18 G A 9: 87,612,770 (GRCm39) T43M probably benign Het
Tm7sf2 T A 19: 6,113,956 (GRCm39) D263V probably damaging Het
Trbv21 T C 6: 41,179,924 (GRCm39) I80T probably damaging Het
Ttc3 T A 16: 94,228,667 (GRCm39) L747Q possibly damaging Het
Ttll11 T C 2: 35,707,813 (GRCm39) D498G possibly damaging Het
Ttn T C 2: 76,583,714 (GRCm39) Y22431C probably null Het
Ubtfl1 T A 9: 18,321,637 (GRCm39) S388R Het
Vmn2r118 A T 17: 55,917,835 (GRCm39) L226I possibly damaging Het
Wdr46 A G 17: 34,168,156 (GRCm39) H576R probably benign Het
Zfp426 A G 9: 20,386,296 (GRCm39) F62L probably damaging Het
Other mutations in Adcy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Adcy4 APN 14 56,011,120 (GRCm39) splice site probably null
IGL02406:Adcy4 APN 14 56,007,504 (GRCm39) missense possibly damaging 0.45
IGL02503:Adcy4 APN 14 56,008,962 (GRCm39) missense probably damaging 1.00
IGL02543:Adcy4 APN 14 56,006,627 (GRCm39) missense probably benign
IGL02616:Adcy4 APN 14 56,020,971 (GRCm39) splice site probably null
IGL03002:Adcy4 APN 14 56,011,013 (GRCm39) missense probably benign 0.31
IGL03026:Adcy4 APN 14 56,015,467 (GRCm39) missense probably damaging 1.00
IGL03190:Adcy4 APN 14 56,016,510 (GRCm39) missense probably damaging 1.00
IGL03247:Adcy4 APN 14 56,007,553 (GRCm39) missense probably damaging 1.00
stressed UTSW 14 56,016,556 (GRCm39) splice site probably null
IGL03098:Adcy4 UTSW 14 56,019,038 (GRCm39) missense probably null 0.82
R0098:Adcy4 UTSW 14 56,007,284 (GRCm39) missense possibly damaging 0.78
R0102:Adcy4 UTSW 14 56,008,990 (GRCm39) missense probably benign 0.29
R0396:Adcy4 UTSW 14 56,009,745 (GRCm39) missense probably benign 0.00
R0482:Adcy4 UTSW 14 56,012,029 (GRCm39) critical splice acceptor site probably null
R0634:Adcy4 UTSW 14 56,019,054 (GRCm39) missense probably benign
R0691:Adcy4 UTSW 14 56,010,104 (GRCm39) splice site probably benign
R0704:Adcy4 UTSW 14 56,010,213 (GRCm39) missense probably benign
R0815:Adcy4 UTSW 14 56,021,056 (GRCm39) missense probably damaging 1.00
R0863:Adcy4 UTSW 14 56,021,056 (GRCm39) missense probably damaging 1.00
R1446:Adcy4 UTSW 14 56,007,480 (GRCm39) critical splice donor site probably null
R1462:Adcy4 UTSW 14 56,015,765 (GRCm39) missense possibly damaging 0.78
R1462:Adcy4 UTSW 14 56,015,765 (GRCm39) missense possibly damaging 0.78
R1463:Adcy4 UTSW 14 56,016,396 (GRCm39) missense probably damaging 1.00
R1624:Adcy4 UTSW 14 56,019,384 (GRCm39) missense possibly damaging 0.68
R1799:Adcy4 UTSW 14 56,008,929 (GRCm39) missense probably benign 0.01
R1878:Adcy4 UTSW 14 56,007,362 (GRCm39) missense probably damaging 0.96
R2007:Adcy4 UTSW 14 56,015,770 (GRCm39) missense possibly damaging 0.45
R2156:Adcy4 UTSW 14 56,006,627 (GRCm39) missense probably benign 0.09
R2425:Adcy4 UTSW 14 56,015,474 (GRCm39) missense probably damaging 0.99
R2517:Adcy4 UTSW 14 56,019,403 (GRCm39) missense probably damaging 1.00
R3882:Adcy4 UTSW 14 56,012,003 (GRCm39) missense probably benign 0.27
R4021:Adcy4 UTSW 14 56,012,635 (GRCm39) splice site probably null
R4022:Adcy4 UTSW 14 56,012,635 (GRCm39) splice site probably null
R4411:Adcy4 UTSW 14 56,006,900 (GRCm39) missense probably damaging 1.00
R4530:Adcy4 UTSW 14 56,016,485 (GRCm39) missense probably damaging 1.00
R4560:Adcy4 UTSW 14 56,016,407 (GRCm39) splice site probably null
R4704:Adcy4 UTSW 14 56,012,482 (GRCm39) missense possibly damaging 0.91
R4780:Adcy4 UTSW 14 56,012,493 (GRCm39) missense probably benign 0.07
R4860:Adcy4 UTSW 14 56,019,384 (GRCm39) missense possibly damaging 0.68
R4860:Adcy4 UTSW 14 56,019,384 (GRCm39) missense possibly damaging 0.68
R4868:Adcy4 UTSW 14 56,011,179 (GRCm39) missense probably benign
R4890:Adcy4 UTSW 14 56,016,486 (GRCm39) missense probably damaging 1.00
R4920:Adcy4 UTSW 14 56,016,486 (GRCm39) missense probably damaging 1.00
R4948:Adcy4 UTSW 14 56,016,486 (GRCm39) missense probably damaging 1.00
R4952:Adcy4 UTSW 14 56,016,486 (GRCm39) missense probably damaging 1.00
R4953:Adcy4 UTSW 14 56,016,486 (GRCm39) missense probably damaging 1.00
R4987:Adcy4 UTSW 14 56,010,934 (GRCm39) missense probably benign 0.01
R4991:Adcy4 UTSW 14 56,010,922 (GRCm39) missense probably benign 0.03
R5080:Adcy4 UTSW 14 56,009,832 (GRCm39) missense probably damaging 0.98
R5620:Adcy4 UTSW 14 56,009,824 (GRCm39) nonsense probably null
R5652:Adcy4 UTSW 14 56,010,900 (GRCm39) missense probably benign
R5726:Adcy4 UTSW 14 56,021,118 (GRCm39) missense probably damaging 1.00
R5910:Adcy4 UTSW 14 56,016,470 (GRCm39) missense probably damaging 1.00
R5958:Adcy4 UTSW 14 56,016,556 (GRCm39) splice site probably null
R6280:Adcy4 UTSW 14 56,016,500 (GRCm39) missense probably damaging 1.00
R6318:Adcy4 UTSW 14 56,006,681 (GRCm39) missense probably damaging 1.00
R6598:Adcy4 UTSW 14 56,007,502 (GRCm39) missense probably benign 0.03
R6947:Adcy4 UTSW 14 56,015,848 (GRCm39) missense possibly damaging 0.92
R7012:Adcy4 UTSW 14 56,017,376 (GRCm39) missense possibly damaging 0.95
R7147:Adcy4 UTSW 14 56,017,182 (GRCm39) missense probably damaging 1.00
R7386:Adcy4 UTSW 14 56,015,784 (GRCm39) missense probably damaging 1.00
R7414:Adcy4 UTSW 14 56,019,090 (GRCm39) missense probably benign 0.15
R7431:Adcy4 UTSW 14 56,010,129 (GRCm39) missense probably benign 0.01
R7490:Adcy4 UTSW 14 56,007,890 (GRCm39) missense possibly damaging 0.66
R7552:Adcy4 UTSW 14 56,010,922 (GRCm39) missense probably benign 0.00
R7672:Adcy4 UTSW 14 56,018,362 (GRCm39) missense probably benign 0.14
R8003:Adcy4 UTSW 14 56,019,092 (GRCm39) missense probably benign 0.00
R8042:Adcy4 UTSW 14 56,012,696 (GRCm39) missense probably benign 0.01
R8100:Adcy4 UTSW 14 56,009,722 (GRCm39) nonsense probably null
R8343:Adcy4 UTSW 14 56,012,697 (GRCm39) missense probably benign 0.02
R8801:Adcy4 UTSW 14 56,009,452 (GRCm39) missense probably benign 0.05
R8811:Adcy4 UTSW 14 56,010,221 (GRCm39) missense probably benign
R8993:Adcy4 UTSW 14 56,008,835 (GRCm39) missense probably null 1.00
R9026:Adcy4 UTSW 14 56,016,426 (GRCm39) missense probably damaging 1.00
X0025:Adcy4 UTSW 14 56,007,848 (GRCm39) missense probably damaging 1.00
Z1088:Adcy4 UTSW 14 56,018,413 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCAGCATCTCAGAATTTCCCTG -3'
(R):5'- ATCAGGTCAGCTCTCGTGTG -3'

Sequencing Primer
(F):5'- CTGCACTTGTCTGAAGGGAC -3'
(R):5'- CTGAGAGCACCAGGTGTTG -3'
Posted On 2021-10-11