Mutagenetix > Incidental Mutations

Incidental Mutation 'R8993:Cntn1'

684568

Institutional Source

Beutler Lab

Gene Symbol

Cntn1

Ensembl Gene

ENSMUSG00000055022

Gene Name

contactin 1

Synonyms

CNTN, F3cam

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8993 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

92051165-92341967 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 92234466 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 148 (V148M)

Ref Sequence

ENSEMBL: ENSMUSP00000000109 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000109] [ENSMUST00000068378] [ENSMUST00000169825]

AlphaFold

P12960

Predicted Effect

probably damaging
Transcript: ENSMUST00000000109
AA Change: V148M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000000109
Gene: ENSMUSG00000055022
AA Change: V148M

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IGc2	56	121	4.07e-4	SMART
IG	143	232	1.25e-4	SMART
IGc2	254	317	1.24e-17	SMART
IGc2	343	398	4.22e-11	SMART
IGc2	427	491	2.52e-9	SMART
IG	511	603	3.51e-8	SMART
FN3	606	692	6.69e-12	SMART
FN3	709	795	1.17e-2	SMART
FN3	811	892	1.16e-6	SMART
FN3	907	987	2.46e-1	SMART
low complexity region	995	1018	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000068378
AA Change: V148M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000067842
Gene: ENSMUSG00000055022
AA Change: V148M

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IGc2	56	121	4.07e-4	SMART
IG	143	232	1.25e-4	SMART
IGc2	254	317	1.24e-17	SMART
IGc2	343	398	4.22e-11	SMART
IGc2	427	491	2.52e-9	SMART
IG	511	603	3.51e-8	SMART
FN3	606	692	6.69e-12	SMART
FN3	709	795	1.17e-2	SMART
FN3	811	892	1.16e-6	SMART
FN3	907	987	2.46e-1	SMART
low complexity region	995	1018	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169825
AA Change: V148M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133063
Gene: ENSMUSG00000055022
AA Change: V148M

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IGc2	56	121	4.07e-4	SMART
IG	143	232	1.25e-4	SMART
IGc2	254	317	1.24e-17	SMART
IGc2	343	398	4.22e-11	SMART
IGc2	427	491	2.52e-9	SMART
IG	511	603	3.51e-8	SMART
FN3	606	692	6.69e-12	SMART
FN3	709	795	1.17e-2	SMART
FN3	811	892	1.16e-6	SMART
FN3	907	987	2.46e-1	SMART
low complexity region	995	1018	N/A	INTRINSIC

Meta Mutation Damage Score

0.6329

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mutations of this gene result in growth retardation, progressive ataxia and death prior to weaning. A targeted null mutation, but not a spontaneous mutation, causes a small cerebellum with abnormalities of the molecular layer and abnormal Purkinje cellaxon morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700069L16Rik	A	T	5: 113,703,781	C92*	probably null	Het
A830018L16Rik	G	T	1: 11,545,267	E155*	probably null	Het
Acaa1a	A	T	9: 119,349,352		probably null	Het
Adcy4	T	C	14: 55,771,378	E864G	probably null	Het
Adcy4	T	C	14: 55,778,699	D387G	probably damaging	Het
Ank1	C	T	8: 23,098,939	H574Y	probably damaging	Het
Arhgef16	C	T	4: 154,287,038	E233K	probably damaging	Het
Arhgef26	A	T	3: 62,448,104	Y699F	probably benign	Het
BB014433	C	T	8: 15,042,101	V251M	probably damaging	Het
Bcan	G	A	3: 87,994,222	A391V	probably benign	Het
Bod1l	A	C	5: 41,816,867	V2368G	probably benign	Het
Braf	A	G	6: 39,662,151	V222A	probably damaging	Het
Cd33	G	T	7: 43,533,447		probably benign	Het
Cdkl2	T	A	5: 92,022,151	K324N	probably damaging	Het
Celf6	A	T	9: 59,602,871	T199S	probably damaging	Het
Cmtm4	A	C	8: 104,355,166	D196E	probably benign	Het
Col1a2	C	A	6: 4,535,451	P921H	unknown	Het
Crmp1	T	C	5: 37,242,146	M1T	probably null	Het
Dnah7a	A	T	1: 53,504,103	Y2303N	probably damaging	Het
Dock10	G	T	1: 80,574,171	T650K	probably benign	Het
Fam24a	A	G	7: 131,336,540	D53G	probably benign	Het
Foxa2	A	T	2: 148,044,706	M69K	probably benign	Het
Gatad2a	T	A	8: 69,909,935	H601L	probably damaging	Het
Gimap4	A	C	6: 48,690,605	D98A	probably damaging	Het
Gm14295	G	T	2: 176,809,830	R371L	possibly damaging	Het
Gm5039	A	G	12: 88,321,400	F28L	probably benign	Het
Golim4	G	T	3: 75,878,128	A652E	probably benign	Het
Grid1	A	G	14: 35,026,942	I240V	probably benign	Het
Iqsec3	T	A	6: 121,413,313	T400S	unknown	Het
Itk	G	A	11: 46,334,908	R539C	probably damaging	Het
Kdelc1	G	T	1: 44,112,764	L322I	possibly damaging	Het
Kif27	T	A	13: 58,326,098	D695V	possibly damaging	Het
Krt79	T	C	15: 101,931,006		probably benign	Het
Lama2	C	A	10: 27,422,714	V129L	possibly damaging	Het
Lonrf1	C	A	8: 36,229,238	E552D	possibly damaging	Het
Mpp3	A	G	11: 102,000,665	I549T	probably benign	Het
Nat1	T	C	8: 67,491,742	Y260H	probably benign	Het
Nipal2	T	A	15: 34,648,837	K69*	probably null	Het
Nlrx1	G	T	9: 44,256,941		probably benign	Het
Pde1b	C	A	15: 103,521,425	A115E	probably benign	Het
Pde4dip	A	G	3: 97,766,494	Y369H	probably damaging	Het
Pnpla7	A	G	2: 25,053,419	Y1286C	possibly damaging	Het
Pramel5	T	C	4: 144,272,959	E186G	possibly damaging	Het
Qdpr	C	T	5: 45,450,044	G20D	probably damaging	Het
Rmnd1	T	G	10: 4,407,918	I364L	probably benign	Het
Slc5a4a	A	T	10: 76,186,535	E568V	probably benign	Het
Slc6a18	T	A	13: 73,668,271	I330F	probably benign	Het
Spesp1	T	C	9: 62,273,270	T119A	possibly damaging	Het
Sypl	G	A	12: 32,975,663	S242N	probably benign	Het
Tbx18	G	A	9: 87,730,717	T43M	probably benign	Het
Tm7sf2	T	A	19: 6,063,926	D263V	probably damaging	Het
Trbv21	T	C	6: 41,202,990	I80T	probably damaging	Het
Ttc3	T	A	16: 94,427,808	L747Q	possibly damaging	Het
Ttll11	T	C	2: 35,817,801	D498G	possibly damaging	Het
Ttn	T	C	2: 76,753,370	Y22431C	probably null	Het
Ubtfl1	T	A	9: 18,410,341	S388R		Het
Vmn2r118	A	T	17: 55,610,835	L226I	possibly damaging	Het
Wdr46	A	G	17: 33,949,182	H576R	probably benign	Het
Zfp426	A	G	9: 20,475,000	F62L	probably damaging	Het

Other mutations in Cntn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Cntn1	APN	15	92250877	missense	possibly damaging	0.92
IGL01109:Cntn1	APN	15	92339577	nonsense	probably null
IGL01399:Cntn1	APN	15	92305144	missense	probably damaging	1.00
IGL01714:Cntn1	APN	15	92253989	nonsense	probably null
IGL02052:Cntn1	APN	15	92291703	missense	possibly damaging	0.95
IGL02342:Cntn1	APN	15	92246017	missense	probably benign	0.01
IGL02507:Cntn1	APN	15	92250979	missense	possibly damaging	0.92
IGL02511:Cntn1	APN	15	92216385	start gained	probably benign
IGL02702:Cntn1	APN	15	92291601	splice site	probably benign
IGL02927:Cntn1	APN	15	92291680	missense	probably benign	0.12
IGL02948:Cntn1	APN	15	92246010	missense	probably benign	0.01
R0035:Cntn1	UTSW	15	92232088	splice site	probably benign
R0084:Cntn1	UTSW	15	92317917	missense	probably benign	0.01
R0346:Cntn1	UTSW	15	92232087	splice site	probably benign
R0634:Cntn1	UTSW	15	92314563	nonsense	probably null
R1348:Cntn1	UTSW	15	92314663	missense	probably damaging	1.00
R1613:Cntn1	UTSW	15	92245990	missense	possibly damaging	0.60
R1793:Cntn1	UTSW	15	92291671	missense	possibly damaging	0.92
R1815:Cntn1	UTSW	15	92250948	missense	probably benign	0.00
R1851:Cntn1	UTSW	15	92305140	missense	probably damaging	1.00
R1852:Cntn1	UTSW	15	92305140	missense	probably damaging	1.00
R2068:Cntn1	UTSW	15	92318062	missense	possibly damaging	0.82
R2269:Cntn1	UTSW	15	92294982	splice site	probably benign
R4394:Cntn1	UTSW	15	92291764	missense	probably damaging	1.00
R4667:Cntn1	UTSW	15	92295079	missense	probably damaging	1.00
R4771:Cntn1	UTSW	15	92305091	missense	possibly damaging	0.82
R4944:Cntn1	UTSW	15	92228668	missense	probably damaging	1.00
R5044:Cntn1	UTSW	15	92242995	missense	probably damaging	1.00
R5218:Cntn1	UTSW	15	92339549	missense	unknown
R5314:Cntn1	UTSW	15	92295011	missense	probably benign	0.01
R5445:Cntn1	UTSW	15	92295077	missense	probably damaging	1.00
R5518:Cntn1	UTSW	15	92314653	missense	probably benign	0.00
R6849:Cntn1	UTSW	15	92305246	missense	probably damaging	0.99
R6885:Cntn1	UTSW	15	92243099	critical splice donor site	probably null
R7035:Cntn1	UTSW	15	92314511	missense	probably benign	0.04
R7070:Cntn1	UTSW	15	92254036	missense	probably damaging	1.00
R7287:Cntn1	UTSW	15	92245952	splice site	probably null
R7311:Cntn1	UTSW	15	92232275	critical splice donor site	probably null
R7401:Cntn1	UTSW	15	92317989	missense	probably benign
R7484:Cntn1	UTSW	15	92254041	missense	probably benign	0.00
R7492:Cntn1	UTSW	15	92314542	missense	probably benign
R7617:Cntn1	UTSW	15	92246089	missense	probably damaging	1.00
R7644:Cntn1	UTSW	15	92310009	missense	probably benign	0.14
R7878:Cntn1	UTSW	15	92295053	missense	probably damaging	1.00
R8354:Cntn1	UTSW	15	92232249	missense	probably benign
R8454:Cntn1	UTSW	15	92232249	missense	probably benign
R8465:Cntn1	UTSW	15	92339523	frame shift	probably null
R8757:Cntn1	UTSW	15	92255920	missense	possibly damaging	0.90
R8759:Cntn1	UTSW	15	92255920	missense	possibly damaging	0.90
R8767:Cntn1	UTSW	15	92234466	missense	probably damaging	1.00
R8768:Cntn1	UTSW	15	92234466	missense	probably damaging	1.00
R8885:Cntn1	UTSW	15	92261499	missense	probably benign	0.00
R8972:Cntn1	UTSW	15	92252397	missense	probably benign	0.18
R8995:Cntn1	UTSW	15	92234466	missense	probably damaging	1.00
R8997:Cntn1	UTSW	15	92234466	missense	probably damaging	1.00
R9151:Cntn1	UTSW	15	92242983	missense	probably damaging	1.00
R9438:Cntn1	UTSW	15	92246143	critical splice donor site	probably null
Z1177:Cntn1	UTSW	15	92309970	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCCAAACGGGGTCCTTTCC -3'
(R):5'- CGTTAATGATGGACCATGACTG -3'

Sequencing Primer
(F):5'- AGTGTCTGATCTGCCAACAG -3'
(R):5'- GGACCATGACTGTTAAATGAATTGAG -3'

Posted On

2021-10-11