Incidental Mutation 'R8994:Klk1b27'
ID 684595
Institutional Source Beutler Lab
Gene Symbol Klk1b27
Ensembl Gene ENSMUSG00000063177
Gene Name kallikrein 1-related peptidase b27
Synonyms mGK-27, Klk27, Klk21l
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock # R8994 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 44052290-44056712 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 44055712 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 101 (H101R)
Ref Sequence ENSEMBL: ENSMUSP00000078786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079859]
AlphaFold Q9JM71
Predicted Effect probably damaging
Transcript: ENSMUST00000079859
AA Change: H101R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078786
Gene: ENSMUSG00000063177
AA Change: H101R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 255 1.87e-97 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T A 14: 118,534,144 probably null Het
Adgrv1 GTT GT 13: 81,405,338 probably null Het
Ank2 A T 3: 126,929,822 M952K probably benign Het
Ccser2 A T 14: 36,940,119 N369K probably benign Het
Cd300e A T 11: 115,055,522 Y38N probably damaging Het
Crat G T 2: 30,407,875 F212L probably damaging Het
Ddx58 C A 4: 40,205,941 E884* probably null Het
Dnah8 T A 17: 30,790,833 S3733T probably benign Het
Fam135a C T 1: 24,028,540 D1083N probably damaging Het
Fam174a C A 1: 95,313,964 P50T possibly damaging Het
Fam71e1 G T 7: 44,496,918 R16L probably benign Het
Fars2 T A 13: 36,204,866 Y113N probably damaging Het
Fpr3 T C 17: 17,971,079 I204T possibly damaging Het
Frmd3 T C 4: 74,170,748 V394A probably benign Het
Gpbp1 C A 13: 111,466,850 probably null Het
Hectd4 T A 5: 121,303,566 F1197Y probably benign Het
Herc3 A G 6: 58,874,343 T526A probably benign Het
Hnrnpul2 T C 19: 8,824,986 C406R probably damaging Het
Hsd17b3 T C 13: 64,062,881 Q220R probably damaging Het
Igf2r T A 17: 12,716,650 Y651F possibly damaging Het
Kcng1 C T 2: 168,268,848 R132Q probably benign Het
Kif1a G A 1: 93,055,735 S680F possibly damaging Het
Kif1b T C 4: 149,195,482 D27G Het
Klk12 A T 7: 43,772,061 T180S probably damaging Het
Lrp6 C A 6: 134,541,693 E136D probably benign Het
Mcm9 T C 10: 53,548,524 I657V probably benign Het
Med13l A C 5: 118,728,161 K427Q possibly damaging Het
Nol10 A T 12: 17,352,716 D63V probably damaging Het
Nudcd2 A G 11: 40,734,035 T24A probably damaging Het
Nup155 T C 15: 8,143,161 probably null Het
Olfr129 T C 17: 38,055,329 Y79C possibly damaging Het
Olfr510 G A 7: 108,667,962 C182Y probably damaging Het
Olfr609 A T 7: 103,492,593 M95K probably benign Het
Olfr796 A T 10: 129,608,136 L115H probably damaging Het
Olfr897-ps1 A T 9: 38,309,285 *163Y probably null Het
Piezo1 T C 8: 122,483,090 D2314G unknown Het
Pkhd1l1 T C 15: 44,547,103 F2669L probably damaging Het
Plpp4 A G 7: 129,379,433 R178G probably damaging Het
Ppp1r13l G T 7: 19,368,770 A37S possibly damaging Het
Prl6a1 A G 13: 27,315,434 T62A probably benign Het
Ranbp2 C A 10: 58,480,069 Q2204K possibly damaging Het
Rbm48 T A 5: 3,590,795 M195L probably benign Het
Shank3 T A 15: 89,533,213 F4L probably benign Het
Slain2 T A 5: 72,957,641 V405D probably damaging Het
Slitrk5 A C 14: 111,680,795 D617A probably benign Het
Sp140 T A 1: 85,621,882 probably null Het
Stk32a A G 18: 43,310,477 T240A probably benign Het
Timm21 T C 18: 84,951,364 probably benign Het
Tmem131 T C 1: 36,815,457 S904G probably benign Het
Tmem86b A G 7: 4,629,707 C53R unknown Het
Wdr33 T C 18: 31,827,406 L41P probably benign Het
Zfp112 A C 7: 24,126,065 H490P probably benign Het
Zfp455 T C 13: 67,207,414 Y184H probably damaging Het
Other mutations in Klk1b27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Klk1b27 APN 7 44056143 critical splice donor site probably null
IGL01328:Klk1b27 APN 7 44055879 missense probably damaging 1.00
IGL01552:Klk1b27 APN 7 44054615 missense probably damaging 1.00
IGL01632:Klk1b27 APN 7 44056673 utr 3 prime probably benign
R0574:Klk1b27 UTSW 7 44056101 missense probably damaging 1.00
R4723:Klk1b27 UTSW 7 44056532 missense probably damaging 1.00
R5800:Klk1b27 UTSW 7 44055664 missense probably benign 0.21
R6002:Klk1b27 UTSW 7 44055690 missense probably benign
R6244:Klk1b27 UTSW 7 44054550 missense probably benign 0.05
R6513:Klk1b27 UTSW 7 44055745 missense probably benign 0.00
R6584:Klk1b27 UTSW 7 44054511 missense possibly damaging 0.84
R6633:Klk1b27 UTSW 7 44055810 missense probably damaging 0.98
R7074:Klk1b27 UTSW 7 44056553 missense probably damaging 1.00
R7495:Klk1b27 UTSW 7 44056076 missense probably benign
R7830:Klk1b27 UTSW 7 44055726 missense probably benign 0.00
R8002:Klk1b27 UTSW 7 44056021 missense probably benign 0.01
R8969:Klk1b27 UTSW 7 44054508 missense probably damaging 0.99
R9020:Klk1b27 UTSW 7 44055694 missense probably damaging 1.00
R9104:Klk1b27 UTSW 7 44055886 nonsense probably null
X0024:Klk1b27 UTSW 7 44056593 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AAGTTCAGCCCTGTCCTAGC -3'
(R):5'- CCACACCAAGCTGTATCCTTG -3'

Sequencing Primer
(F):5'- TGTCCTAGCTGCACCTGAG -3'
(R):5'- GCTGTATCCTTGGAGAAGACTCAC -3'
Posted On 2021-10-11