Incidental Mutation 'R8994:Hsd17b3'
ID 684610
Institutional Source Beutler Lab
Gene Symbol Hsd17b3
Ensembl Gene ENSMUSG00000033122
Gene Name hydroxysteroid (17-beta) dehydrogenase 3
Synonyms 17(beta)HSD type 3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8994 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 64058266-64089230 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 64062881 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 220 (Q220R)
Ref Sequence ENSEMBL: ENSMUSP00000044217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039832] [ENSMUST00000166224] [ENSMUST00000222783] [ENSMUST00000222810]
AlphaFold P70385
Predicted Effect probably damaging
Transcript: ENSMUST00000039832
AA Change: Q220R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044217
Gene: ENSMUSG00000033122
AA Change: Q220R

DomainStartEndE-ValueType
Pfam:adh_short 45 213 3.4e-26 PFAM
Pfam:adh_short_C2 51 272 1.2e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166224
AA Change: Q220R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132011
Gene: ENSMUSG00000033122
AA Change: Q220R

DomainStartEndE-ValueType
Pfam:adh_short 45 240 2.4e-48 PFAM
Pfam:adh_short_C2 51 272 3.8e-13 PFAM
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000222783
AA Change: Q220R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222810
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This isoform of 17 beta-hydroxysteroid dehydrogenase is expressed predominantly in the testis and catalyzes the conversion of androstenedione to testosterone. It preferentially uses NADP as cofactor. Deficiency can result in male pseudohermaphroditism with gynecomastia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T A 14: 118,534,144 probably null Het
Adgrv1 GTT GT 13: 81,405,338 probably null Het
Ank2 A T 3: 126,929,822 M952K probably benign Het
Ccser2 A T 14: 36,940,119 N369K probably benign Het
Cd300e A T 11: 115,055,522 Y38N probably damaging Het
Crat G T 2: 30,407,875 F212L probably damaging Het
Ddx58 C A 4: 40,205,941 E884* probably null Het
Dnah8 T A 17: 30,790,833 S3733T probably benign Het
Fam135a C T 1: 24,028,540 D1083N probably damaging Het
Fam174a C A 1: 95,313,964 P50T possibly damaging Het
Fam71e1 G T 7: 44,496,918 R16L probably benign Het
Fars2 T A 13: 36,204,866 Y113N probably damaging Het
Fpr3 T C 17: 17,971,079 I204T possibly damaging Het
Frmd3 T C 4: 74,170,748 V394A probably benign Het
Gpbp1 C A 13: 111,466,850 probably null Het
Hectd4 T A 5: 121,303,566 F1197Y probably benign Het
Herc3 A G 6: 58,874,343 T526A probably benign Het
Hnrnpul2 T C 19: 8,824,986 C406R probably damaging Het
Igf2r T A 17: 12,716,650 Y651F possibly damaging Het
Kcng1 C T 2: 168,268,848 R132Q probably benign Het
Kif1a G A 1: 93,055,735 S680F possibly damaging Het
Kif1b T C 4: 149,195,482 D27G Het
Klk12 A T 7: 43,772,061 T180S probably damaging Het
Klk1b27 A G 7: 44,055,712 H101R probably damaging Het
Lrp6 C A 6: 134,541,693 E136D probably benign Het
Mcm9 T C 10: 53,548,524 I657V probably benign Het
Med13l A C 5: 118,728,161 K427Q possibly damaging Het
Nol10 A T 12: 17,352,716 D63V probably damaging Het
Nudcd2 A G 11: 40,734,035 T24A probably damaging Het
Nup155 T C 15: 8,143,161 probably null Het
Olfr129 T C 17: 38,055,329 Y79C possibly damaging Het
Olfr510 G A 7: 108,667,962 C182Y probably damaging Het
Olfr609 A T 7: 103,492,593 M95K probably benign Het
Olfr796 A T 10: 129,608,136 L115H probably damaging Het
Olfr897-ps1 A T 9: 38,309,285 *163Y probably null Het
Piezo1 T C 8: 122,483,090 D2314G unknown Het
Pkhd1l1 T C 15: 44,547,103 F2669L probably damaging Het
Plpp4 A G 7: 129,379,433 R178G probably damaging Het
Ppp1r13l G T 7: 19,368,770 A37S possibly damaging Het
Prl6a1 A G 13: 27,315,434 T62A probably benign Het
Ranbp2 C A 10: 58,480,069 Q2204K possibly damaging Het
Rbm48 T A 5: 3,590,795 M195L probably benign Het
Shank3 T A 15: 89,533,213 F4L probably benign Het
Slain2 T A 5: 72,957,641 V405D probably damaging Het
Slitrk5 A C 14: 111,680,795 D617A probably benign Het
Sp140 T A 1: 85,621,882 probably null Het
Stk32a A G 18: 43,310,477 T240A probably benign Het
Timm21 T C 18: 84,951,364 probably benign Het
Tmem131 T C 1: 36,815,457 S904G probably benign Het
Tmem86b A G 7: 4,629,707 C53R unknown Het
Wdr33 T C 18: 31,827,406 L41P probably benign Het
Zfp112 A C 7: 24,126,065 H490P probably benign Het
Zfp455 T C 13: 67,207,414 Y184H probably damaging Het
Other mutations in Hsd17b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Hsd17b3 APN 13 64062905 missense probably damaging 1.00
IGL02221:Hsd17b3 APN 13 64089051 missense probably benign 0.01
IGL02257:Hsd17b3 APN 13 64059462 missense probably benign 0.14
IGL02745:Hsd17b3 APN 13 64087176 missense probably benign 0.01
IGL03189:Hsd17b3 APN 13 64063087 critical splice donor site probably null
hermine UTSW 13 64062906 missense probably damaging 1.00
IGL02988:Hsd17b3 UTSW 13 64089100 missense probably damaging 0.96
R0116:Hsd17b3 UTSW 13 64058589 missense possibly damaging 0.87
R0659:Hsd17b3 UTSW 13 64073936 missense possibly damaging 0.87
R0684:Hsd17b3 UTSW 13 64089068 missense probably benign
R0834:Hsd17b3 UTSW 13 64089122 missense probably benign 0.00
R3750:Hsd17b3 UTSW 13 64063179 splice site probably null
R3845:Hsd17b3 UTSW 13 64089062 missense possibly damaging 0.94
R3973:Hsd17b3 UTSW 13 64059486 missense probably damaging 1.00
R4602:Hsd17b3 UTSW 13 64063170 critical splice acceptor site probably null
R5027:Hsd17b3 UTSW 13 64062906 missense probably damaging 1.00
R5470:Hsd17b3 UTSW 13 64073899 missense probably damaging 1.00
R5897:Hsd17b3 UTSW 13 64088985 critical splice donor site probably null
R5992:Hsd17b3 UTSW 13 64059470 splice site probably null
R6898:Hsd17b3 UTSW 13 64059525 missense probably benign 0.06
R7297:Hsd17b3 UTSW 13 64076351 missense probably damaging 1.00
R7555:Hsd17b3 UTSW 13 64072002 missense probably benign 0.17
R8743:Hsd17b3 UTSW 13 64062898 missense probably benign 0.00
R8786:Hsd17b3 UTSW 13 64072048 missense probably damaging 1.00
R8904:Hsd17b3 UTSW 13 64064380 missense probably damaging 1.00
R9324:Hsd17b3 UTSW 13 64058645 missense possibly damaging 0.49
Z1176:Hsd17b3 UTSW 13 64063138 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCAGAAATCTCAGCAGCAGGAG -3'
(R):5'- GCCTGTACTCAGCTTCCAAG -3'

Sequencing Primer
(F):5'- TCTCAGCAGCAGGAGGGATTG -3'
(R):5'- GTGAGTGACAAGTTACCCAAGTCTC -3'
Posted On 2021-10-11