Mutagenetix > Incidental Mutation

Incidental Mutation 'R8995:Lamc1'

684632

Institutional Source

Beutler Lab

Gene Symbol

Lamc1

Ensembl Gene

ENSMUSG00000026478

Gene Name

laminin, gamma 1

Synonyms

laminin B2, Lamb2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8995 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

153218922-153332786 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 153332247 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 98 (Q98R)

Ref Sequence

ENSEMBL: ENSMUSP00000027752 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027752]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000027752
AA Change: Q98R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000027752
Gene: ENSMUSG00000026478
AA Change: Q98R

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
LamNT	42	282	1.97e-150	SMART
EGF_Lam	284	337	7.18e-7	SMART
EGF_Lam	340	393	7.93e-9	SMART
EGF_Lam	396	440	2.11e-13	SMART
EGF_Lam	443	490	2.87e-15	SMART
LamB	551	676	5.52e-48	SMART
Pfam:Laminin_EGF	683	718	1.3e-4	PFAM
EGF_Lam	722	768	2.38e-12	SMART
EGF_Lam	771	823	1.39e-4	SMART
EGF_Lam	826	879	8.05e-10	SMART
EGF_Lam	882	930	8.9e-12	SMART
EGF_Lam	933	978	1.26e-11	SMART
EGF_Lam	981	1026	7.4e-9	SMART
coiled coil region	1063	1594	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 1. The gamma 1 chain, formerly thought to be a beta chain, contains structural domains similar to beta chains, however, lacks the short alpha region separating domains I and II. The structural organization of this gene also suggested that it had diverged considerably from the beta chain genes. Embryos of transgenic mice in which both alleles of the gamma 1 chain gene were inactivated by homologous recombination, lacked basement membranes, indicating that laminin, gamma 1 chain is necessary for laminin heterotrimer assembly. It has been inferred by analogy with the strikingly similar 3' UTR sequence in mouse laminin gamma 1 cDNA, that multiple polyadenylation sites are utilized in human to generate the 2 different sized mRNAs (5.5 and 7.5 kb) seen on Northern analysis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a targeted null mutation lack development of basement membranes, migration of primitive endoderm cells out of the inner cell mass, and parietal yolk sac development, resulting in lethality by embryonic day 5.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700018B08Rik	A	G	8: 121,531,025	*214R	probably null	Het
Acd	A	G	8: 105,700,499	L93P	probably damaging	Het
Adgrv1	GTT	GT	13: 81,405,338		probably null	Het
Aldh1b1	T	A	4: 45,803,413	M317K	possibly damaging	Het
Arfgap2	C	A	2: 91,273,584	Q342K	probably damaging	Het
Arhgef16	C	T	4: 154,287,038	E233K	probably damaging	Het
Asxl1	C	T	2: 153,393,966	R323C	probably damaging	Het
Bank1	G	T	3: 136,066,503	D656E	possibly damaging	Het
Bdh2	A	G	3: 135,295,228	M120V	probably damaging	Het
Bend7	A	G	2: 4,744,292	I73M	probably damaging	Het
Casc4	A	C	2: 121,925,718	E409D	probably damaging	Het
Cd207	C	A	6: 83,675,909	D80Y	probably damaging	Het
Cdon	A	G	9: 35,486,797	T937A	probably damaging	Het
Cntn1	G	A	15: 92,234,466	V148M	probably damaging	Het
Ddx50	A	G	10: 62,634,083	I375T	probably damaging	Het
Dhrs1	T	A	14: 55,739,939	T241S	probably benign	Het
Eef1b2	T	C	1: 63,178,470	Y79H	probably damaging	Het
Elmod2	A	G	8: 83,322,686	C84R	probably benign	Het
Exo1	A	G	1: 175,908,561	H837R	probably benign	Het
Fam207a	G	A	10: 77,497,469	R121*	probably null	Het
Fat3	T	C	9: 16,375,602	N875S	probably damaging	Het
Flvcr1	A	T	1: 191,011,620	L413Q	probably damaging	Het
Fras1	G	T	5: 96,712,556	V2154F	possibly damaging	Het
Gm10031	T	A	1: 156,525,303	V358E	probably benign	Het
Gm31371	A	T	8: 19,903,424	H11L		Het
Hectd4	G	A	5: 121,254,359	V229M	possibly damaging	Het
Ifitm6	A	T	7: 141,016,704	V52E	probably damaging	Het
Igkv4-58	A	G	6: 69,500,527	S29P	probably damaging	Het
Klc1	G	A	12: 111,776,910	A224T	probably damaging	Het
Knl1	T	C	2: 119,072,509	S1564P	probably benign	Het
Krt25	T	C	11: 99,316,556	D399G	probably benign	Het
Lpar1	T	A	4: 58,486,954	M106L	probably damaging	Het
Mpc1	A	G	17: 8,283,952	Y21C	probably benign	Het
Msr1	T	A	8: 39,589,419	I372F	possibly damaging	Het
Ndc80	T	C	17: 71,508,603	N396D	probably benign	Het
Nphp4	G	A	4: 152,538,888	R673H	probably damaging	Het
Nsd3	T	C	8: 25,641,153	F178S	probably damaging	Het
Olfr404-ps1	A	T	11: 74,239,794	T77S	probably benign	Het
Olfr969	T	C	9: 39,796,017	I214T	possibly damaging	Het
Pcdhgb7	T	A	18: 37,752,177	F133L	probably damaging	Het
Pikfyve	A	G	1: 65,205,587		probably null	Het
Pld5	A	T	1: 175,964,014	D475E	probably benign	Het
Prop1	G	A	11: 50,951,060	P173L	possibly damaging	Het
Rabepk	G	A	2: 34,799,830		probably benign	Het
Reln	A	G	5: 21,979,579	I1646T	probably benign	Het
Rexo1	A	T	10: 80,550,261	L321Q	probably damaging	Het
Rfx3	T	A	19: 27,806,325	E382V	probably benign	Het
Rnf20	C	T	4: 49,648,437	T415I	possibly damaging	Het
Rpl10-ps3	T	A	9: 50,344,778	D55V	probably benign	Het
Sag	A	G	1: 87,805,330	T7A	probably benign	Het
Saysd1	G	A	14: 20,082,937	R51C	probably damaging	Het
Shprh	T	A	10: 11,164,830	Y682*	probably null	Het
Slc6a13	T	C	6: 121,325,053	I198T	probably damaging	Het
Smyd5	C	A	6: 85,438,847	C101*	probably null	Het
Spata31d1d	A	G	13: 59,726,607	V1038A	probably benign	Het
Stat6	T	C	10: 127,658,642	S692P	probably benign	Het
Tbc1d9	A	T	8: 83,271,551	M1246L	probably benign	Het
Tmprss5	T	A	9: 49,114,594		probably null	Het
Trim12a	A	T	7: 104,304,325	M193K	probably benign	Het
Ube2t	T	A	1: 134,971,920	L102H	probably damaging	Het
Ubr1	G	A	2: 120,866,553	R1623W	probably damaging	Het
Ush2a	T	G	1: 188,444,653	M1338R	probably damaging	Het
Usp36	A	T	11: 118,284,999	L112Q	probably damaging	Het
Vmn1r53	A	G	6: 90,223,775	M189T	probably benign	Het
Vmn1r54	T	C	6: 90,269,686	V194A	probably benign	Het
Vmn2r33	A	G	7: 7,551,193	V787A	probably damaging	Het
Vps26a	A	G	10: 62,464,679	I236T	probably damaging	Het
Vwde	A	T	6: 13,195,997	L343Q	probably damaging	Het
Xdh	A	G	17: 73,898,374	V1032A	probably damaging	Het
Zan	A	G	5: 137,395,620	F4523S	unknown	Het
Zfand5	T	A	19: 21,277,023	V66E	probably benign	Het
Zfp658	T	A	7: 43,573,374	C358S	possibly damaging	Het
Zfp977	T	A	7: 42,582,648	R64W	probably damaging	Het
Zfp995	C	T	17: 21,880,191	S354N	probably benign	Het

Other mutations in Lamc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Lamc1	APN	1	153240495	missense	probably damaging	1.00
IGL01397:Lamc1	APN	1	153251134	missense	probably damaging	1.00
IGL01661:Lamc1	APN	1	153221573	missense	possibly damaging	0.89
IGL01894:Lamc1	APN	1	153247082	missense	possibly damaging	0.51
IGL02000:Lamc1	APN	1	153240433	missense	probably damaging	1.00
IGL02649:Lamc1	APN	1	153247042	missense	possibly damaging	0.78
IGL02749:Lamc1	APN	1	153249853	missense	possibly damaging	0.51
IGL02819:Lamc1	APN	1	153250661	missense	probably damaging	1.00
IGL02831:Lamc1	APN	1	153247055	missense	probably benign	0.00
IGL03069:Lamc1	APN	1	153239381	missense	probably damaging	1.00
IGL03143:Lamc1	APN	1	153332274	missense	probably benign	0.00
IGL03166:Lamc1	APN	1	153332301	missense	probably benign	0.01
IGL03285:Lamc1	APN	1	153227685	missense	possibly damaging	0.96
IGL03294:Lamc1	APN	1	153262646	missense	probably damaging	1.00
pride	UTSW	1	153247284	missense	probably benign	0.01
Stratum	UTSW	1	153251124	nonsense	probably null
tier	UTSW	1	153250522	missense	probably damaging	1.00
PIT4280001:Lamc1	UTSW	1	153243471	missense	probably damaging	1.00
R0003:Lamc1	UTSW	1	153262439	missense	probably damaging	0.99
R0003:Lamc1	UTSW	1	153262439	missense	probably damaging	0.99
R0027:Lamc1	UTSW	1	153262583	missense	probably damaging	1.00
R0060:Lamc1	UTSW	1	153241868	unclassified	probably benign
R0078:Lamc1	UTSW	1	153229190	missense	probably damaging	0.96
R0157:Lamc1	UTSW	1	153262607	missense	probably benign	0.00
R0282:Lamc1	UTSW	1	153255312	missense	probably benign
R0374:Lamc1	UTSW	1	153251065	splice site	probably benign
R0494:Lamc1	UTSW	1	153246936	critical splice donor site	probably null
R0502:Lamc1	UTSW	1	153246932	splice site	probably benign
R0755:Lamc1	UTSW	1	153247450	missense	possibly damaging	0.94
R0791:Lamc1	UTSW	1	153234580	missense	possibly damaging	0.94
R0791:Lamc1	UTSW	1	153234595	missense	probably damaging	1.00
R0791:Lamc1	UTSW	1	153234612	missense	probably benign	0.01
R0792:Lamc1	UTSW	1	153234580	missense	possibly damaging	0.94
R0792:Lamc1	UTSW	1	153234595	missense	probably damaging	1.00
R0792:Lamc1	UTSW	1	153234612	missense	probably benign	0.01
R0892:Lamc1	UTSW	1	153332254	missense	possibly damaging	0.95
R0941:Lamc1	UTSW	1	153332274	missense	possibly damaging	0.72
R0961:Lamc1	UTSW	1	153221646	frame shift	probably null
R0961:Lamc1	UTSW	1	153221700	missense	probably benign	0.03
R0963:Lamc1	UTSW	1	153243386	missense	probably benign
R1127:Lamc1	UTSW	1	153250459	missense	possibly damaging	0.69
R1173:Lamc1	UTSW	1	153247231	splice site	probably benign
R1175:Lamc1	UTSW	1	153247231	splice site	probably benign
R1449:Lamc1	UTSW	1	153250495	missense	probably benign
R1481:Lamc1	UTSW	1	153221634	missense	probably damaging	1.00
R1565:Lamc1	UTSW	1	153242743	missense	probably benign	0.34
R1583:Lamc1	UTSW	1	153243478	critical splice acceptor site	probably null
R1643:Lamc1	UTSW	1	153258072	splice site	probably benign
R1652:Lamc1	UTSW	1	153249646	missense	probably damaging	1.00
R1691:Lamc1	UTSW	1	153247249	missense	probably benign	0.04
R1854:Lamc1	UTSW	1	153249872	missense	probably damaging	0.99
R2018:Lamc1	UTSW	1	153242632	missense	probably benign	0.07
R2170:Lamc1	UTSW	1	153249142	missense	probably benign	0.07
R2410:Lamc1	UTSW	1	153247395	missense	possibly damaging	0.61
R3438:Lamc1	UTSW	1	153226415	missense	probably benign	0.04
R3615:Lamc1	UTSW	1	153251150	missense	probably damaging	1.00
R3616:Lamc1	UTSW	1	153251150	missense	probably damaging	1.00
R3699:Lamc1	UTSW	1	153255205	missense	possibly damaging	0.79
R3811:Lamc1	UTSW	1	153262708	splice site	probably null
R4285:Lamc1	UTSW	1	153234552	missense	probably damaging	0.99
R4431:Lamc1	UTSW	1	153221528	missense	probably damaging	1.00
R4579:Lamc1	UTSW	1	153247269	missense	probably damaging	1.00
R4625:Lamc1	UTSW	1	153242696	missense	probably benign	0.04
R4649:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4650:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4651:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4652:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4653:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4784:Lamc1	UTSW	1	153231740	missense	probably damaging	1.00
R4785:Lamc1	UTSW	1	153231740	missense	probably damaging	1.00
R4853:Lamc1	UTSW	1	153229100	missense	possibly damaging	0.89
R5216:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5217:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5218:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5219:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5468:Lamc1	UTSW	1	153233564	missense	probably damaging	0.99
R5597:Lamc1	UTSW	1	153251970	missense	probably damaging	1.00
R5754:Lamc1	UTSW	1	153247284	missense	probably benign	0.01
R6233:Lamc1	UTSW	1	153223666	missense	probably benign
R6431:Lamc1	UTSW	1	153221671	missense	probably benign	0.21
R6636:Lamc1	UTSW	1	153241975	missense	possibly damaging	0.93
R6888:Lamc1	UTSW	1	153262492	missense	probably damaging	1.00
R7161:Lamc1	UTSW	1	153226454	missense	probably damaging	1.00
R7240:Lamc1	UTSW	1	153234650	missense	possibly damaging	0.82
R7388:Lamc1	UTSW	1	153249076	missense	probably damaging	1.00
R7474:Lamc1	UTSW	1	153332265	missense	possibly damaging	0.81
R7570:Lamc1	UTSW	1	153243275	missense	possibly damaging	0.64
R7583:Lamc1	UTSW	1	153243232	missense	possibly damaging	0.71
R7597:Lamc1	UTSW	1	153240454	missense	possibly damaging	0.94
R7635:Lamc1	UTSW	1	153249060	missense	probably damaging	1.00
R7976:Lamc1	UTSW	1	153247268	missense	probably damaging	1.00
R8012:Lamc1	UTSW	1	153221612	missense	probably benign	0.04
R8207:Lamc1	UTSW	1	153250522	missense	probably damaging	1.00
R8219:Lamc1	UTSW	1	153247327	missense	probably damaging	1.00
R8227:Lamc1	UTSW	1	153223754	missense	probably benign	0.04
R8315:Lamc1	UTSW	1	153243421	missense	probably benign	0.00
R8417:Lamc1	UTSW	1	153230769	missense	probably damaging	1.00
R8685:Lamc1	UTSW	1	153233542	missense	probably benign	0.31
R8827:Lamc1	UTSW	1	153221678	missense	probably damaging	1.00
R9061:Lamc1	UTSW	1	153251124	nonsense	probably null
R9141:Lamc1	UTSW	1	153247450	missense	probably benign	0.01
R9187:Lamc1	UTSW	1	153221688	nonsense	probably null
R9206:Lamc1	UTSW	1	153250451	missense	probably damaging	1.00
R9222:Lamc1	UTSW	1	153243341	missense	probably damaging	0.96
R9297:Lamc1	UTSW	1	153252000	missense	probably damaging	1.00
R9318:Lamc1	UTSW	1	153252000	missense	probably damaging	1.00
R9377:Lamc1	UTSW	1	153239263	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACCGGATGTTCAAAGCGAG -3'
(R):5'- AGGATCGGCCTCGGGATAC -3'

Sequencing Primer
(F):5'- AATTTCTGTGTGTGGCCCAC -3'
(R):5'- TCGGGATACGCCGCTAG -3'

Posted On

2021-10-11