Incidental Mutation 'R8995:Pld5'
ID 684635
Institutional Source Beutler Lab
Gene Symbol Pld5
Ensembl Gene ENSMUSG00000055214
Gene Name phospholipase D family, member 5
Synonyms B230365F16Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8995 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 175962306-176275312 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 175964014 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 475 (D475E)
Ref Sequence ENSEMBL: ENSMUSP00000069326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065967] [ENSMUST00000111167] [ENSMUST00000125404]
AlphaFold Q3UNN8
Predicted Effect probably benign
Transcript: ENSMUST00000065967
AA Change: D475E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000069326
Gene: ENSMUSG00000055214
AA Change: D475E

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
PLDc 215 242 3.62e-3 SMART
Pfam:PLDc_3 245 421 2e-101 PFAM
PLDc 434 460 6.11e0 SMART
low complexity region 511 521 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111167
AA Change: D413E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106797
Gene: ENSMUSG00000055214
AA Change: D413E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PLDc 153 180 3.62e-3 SMART
PLDc 372 398 6.11e0 SMART
low complexity region 449 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125404
SMART Domains Protein: ENSMUSP00000121428
Gene: ENSMUSG00000055214

DomainStartEndE-ValueType
transmembrane domain 69 91 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik A G 8: 121,531,025 *214R probably null Het
Acd A G 8: 105,700,499 L93P probably damaging Het
Adgrv1 GTT GT 13: 81,405,338 probably null Het
Aldh1b1 T A 4: 45,803,413 M317K possibly damaging Het
Arfgap2 C A 2: 91,273,584 Q342K probably damaging Het
Arhgef16 C T 4: 154,287,038 E233K probably damaging Het
Asxl1 C T 2: 153,393,966 R323C probably damaging Het
Bank1 G T 3: 136,066,503 D656E possibly damaging Het
Bdh2 A G 3: 135,295,228 M120V probably damaging Het
Bend7 A G 2: 4,744,292 I73M probably damaging Het
Casc4 A C 2: 121,925,718 E409D probably damaging Het
Cd207 C A 6: 83,675,909 D80Y probably damaging Het
Cdon A G 9: 35,486,797 T937A probably damaging Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Ddx50 A G 10: 62,634,083 I375T probably damaging Het
Dhrs1 T A 14: 55,739,939 T241S probably benign Het
Eef1b2 T C 1: 63,178,470 Y79H probably damaging Het
Elmod2 A G 8: 83,322,686 C84R probably benign Het
Exo1 A G 1: 175,908,561 H837R probably benign Het
Fam207a G A 10: 77,497,469 R121* probably null Het
Fat3 T C 9: 16,375,602 N875S probably damaging Het
Flvcr1 A T 1: 191,011,620 L413Q probably damaging Het
Fras1 G T 5: 96,712,556 V2154F possibly damaging Het
Gm10031 T A 1: 156,525,303 V358E probably benign Het
Gm31371 A T 8: 19,903,424 H11L Het
Hectd4 G A 5: 121,254,359 V229M possibly damaging Het
Ifitm6 A T 7: 141,016,704 V52E probably damaging Het
Igkv4-58 A G 6: 69,500,527 S29P probably damaging Het
Klc1 G A 12: 111,776,910 A224T probably damaging Het
Knl1 T C 2: 119,072,509 S1564P probably benign Het
Krt25 T C 11: 99,316,556 D399G probably benign Het
Lamc1 T C 1: 153,332,247 Q98R probably benign Het
Lpar1 T A 4: 58,486,954 M106L probably damaging Het
Mpc1 A G 17: 8,283,952 Y21C probably benign Het
Msr1 T A 8: 39,589,419 I372F possibly damaging Het
Ndc80 T C 17: 71,508,603 N396D probably benign Het
Nphp4 G A 4: 152,538,888 R673H probably damaging Het
Nsd3 T C 8: 25,641,153 F178S probably damaging Het
Olfr404-ps1 A T 11: 74,239,794 T77S probably benign Het
Olfr969 T C 9: 39,796,017 I214T possibly damaging Het
Pcdhgb7 T A 18: 37,752,177 F133L probably damaging Het
Pikfyve A G 1: 65,205,587 probably null Het
Prop1 G A 11: 50,951,060 P173L possibly damaging Het
Rabepk G A 2: 34,799,830 probably benign Het
Reln A G 5: 21,979,579 I1646T probably benign Het
Rexo1 A T 10: 80,550,261 L321Q probably damaging Het
Rfx3 T A 19: 27,806,325 E382V probably benign Het
Rnf20 C T 4: 49,648,437 T415I possibly damaging Het
Rpl10-ps3 T A 9: 50,344,778 D55V probably benign Het
Sag A G 1: 87,805,330 T7A probably benign Het
Saysd1 G A 14: 20,082,937 R51C probably damaging Het
Shprh T A 10: 11,164,830 Y682* probably null Het
Slc6a13 T C 6: 121,325,053 I198T probably damaging Het
Smyd5 C A 6: 85,438,847 C101* probably null Het
Spata31d1d A G 13: 59,726,607 V1038A probably benign Het
Stat6 T C 10: 127,658,642 S692P probably benign Het
Tbc1d9 A T 8: 83,271,551 M1246L probably benign Het
Tmprss5 T A 9: 49,114,594 probably null Het
Trim12a A T 7: 104,304,325 M193K probably benign Het
Ube2t T A 1: 134,971,920 L102H probably damaging Het
Ubr1 G A 2: 120,866,553 R1623W probably damaging Het
Ush2a T G 1: 188,444,653 M1338R probably damaging Het
Usp36 A T 11: 118,284,999 L112Q probably damaging Het
Vmn1r53 A G 6: 90,223,775 M189T probably benign Het
Vmn1r54 T C 6: 90,269,686 V194A probably benign Het
Vmn2r33 A G 7: 7,551,193 V787A probably damaging Het
Vps26a A G 10: 62,464,679 I236T probably damaging Het
Vwde A T 6: 13,195,997 L343Q probably damaging Het
Xdh A G 17: 73,898,374 V1032A probably damaging Het
Zan A G 5: 137,395,620 F4523S unknown Het
Zfand5 T A 19: 21,277,023 V66E probably benign Het
Zfp658 T A 7: 43,573,374 C358S possibly damaging Het
Zfp977 T A 7: 42,582,648 R64W probably damaging Het
Zfp995 C T 17: 21,880,191 S354N probably benign Het
Other mutations in Pld5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Pld5 APN 1 176140019 missense probably damaging 1.00
IGL00949:Pld5 APN 1 175975473 missense probably damaging 1.00
IGL01067:Pld5 APN 1 176274879 utr 5 prime probably benign
IGL02174:Pld5 APN 1 176274744 missense possibly damaging 0.86
IGL02380:Pld5 APN 1 176140044 missense probably damaging 0.97
IGL02879:Pld5 APN 1 175970591 missense probably damaging 1.00
R0087:Pld5 UTSW 1 175984459 missense probably damaging 0.98
R0135:Pld5 UTSW 1 175970589 missense probably damaging 1.00
R0144:Pld5 UTSW 1 175970541 missense probably benign 0.00
R0362:Pld5 UTSW 1 175975580 nonsense probably null
R0453:Pld5 UTSW 1 176089956 missense possibly damaging 0.75
R0454:Pld5 UTSW 1 176274729 missense probably benign 0.00
R0722:Pld5 UTSW 1 175975515 missense probably benign 0.34
R0751:Pld5 UTSW 1 176044896 missense probably damaging 0.98
R0785:Pld5 UTSW 1 175975452 splice site probably benign
R1184:Pld5 UTSW 1 176044896 missense probably damaging 0.98
R1501:Pld5 UTSW 1 175975521 missense probably benign 0.36
R1644:Pld5 UTSW 1 175975626 missense possibly damaging 0.86
R2012:Pld5 UTSW 1 175964013 missense probably benign 0.27
R2426:Pld5 UTSW 1 175963976 missense probably benign
R3508:Pld5 UTSW 1 175994037 missense probably damaging 1.00
R3917:Pld5 UTSW 1 175963938 missense probably benign 0.00
R4207:Pld5 UTSW 1 175993875 missense probably damaging 1.00
R4373:Pld5 UTSW 1 176140017 missense probably damaging 1.00
R4828:Pld5 UTSW 1 176274867 missense probably benign 0.06
R4831:Pld5 UTSW 1 176274884 utr 5 prime probably benign
R5861:Pld5 UTSW 1 176090005 missense probably damaging 1.00
R6182:Pld5 UTSW 1 176044854 missense probably benign 0.35
R6191:Pld5 UTSW 1 175970534 missense probably benign 0.04
R6246:Pld5 UTSW 1 175963909 nonsense probably null
R6737:Pld5 UTSW 1 176090022 missense probably damaging 1.00
R7082:Pld5 UTSW 1 176089876 missense probably benign 0.21
R7164:Pld5 UTSW 1 176213621 start codon destroyed probably null 0.00
R7237:Pld5 UTSW 1 176274735 missense possibly damaging 0.79
R7635:Pld5 UTSW 1 175993850 critical splice donor site probably null
R7805:Pld5 UTSW 1 176044914 missense probably damaging 1.00
R7967:Pld5 UTSW 1 176274698 missense probably benign 0.03
R8038:Pld5 UTSW 1 176044897 missense probably benign 0.19
R9033:Pld5 UTSW 1 176140019 missense probably damaging 0.99
R9067:Pld5 UTSW 1 176089908 missense probably benign 0.00
R9156:Pld5 UTSW 1 175975538 missense possibly damaging 0.73
R9156:Pld5 UTSW 1 176074437 missense probably benign 0.05
X0004:Pld5 UTSW 1 176261522 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCATTTGGTCTGAAGCCTTG -3'
(R):5'- GCTGTCATCAGGATTCTGCCTC -3'

Sequencing Primer
(F):5'- TGTCTGTTAGTGAGCTATACGC -3'
(R):5'- GGATTCTGCCTCTCTTATTATTTTGG -3'
Posted On 2021-10-11